TkA01G254990 | RubberDandelionOmics

Gene overview

TkA01G254990

Reference: TK1151 Chr: Chr01 Coordinates: 64310980-64312685 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1221 bp · TkA01G254990|TK1151|cDNA

ATGAAAAATACACTTTTCTTTGTATTTCCTACAATTTCTGACATATGTTGTTTACTTACATACTATGTGCAGTTCTATCATTCAAAGAAGAAACATAAGTTTGTATCACCCATTTTAAAATCTGGAACAATCGAACAAAATGCAAATTCTTCACTTGAAGGGTCATCTTATAAGCAAGATCAAGTAAGAAGAAATCTAATATCAGAGATAGAATCATCTTCAAGATATAAAGACATGGAAACTATATCTACTATCCAGGG...

CDS

Download CDS FASTA

1221 bp · TkA01G254990|TK1151|CDS

ATGAAAAATACACTTTTCTTTGTATTTCCTACAATTTCTGACATATGTTGTTTACTTACATACTATGTGCAGTTCTATCATTCAAAGAAGAAACATAAGTTTGTATCACCCATTTTAAAATCTGGAACAATCGAACAAAATGCAAATTCTTCACTTGAAGGGTCATCTTATAAGCAAGATCAAGTAAGAAGAAATCTAATATCAGAGATAGAATCATCTTCAAGATATAAAGACATGGAAACTATATCTACTATCCAGGG...

Protein

Download Protein FASTA

406 aa · TkA01G254990|TK1151|PROTEIN

MKNTLFFVFPTISDICCLLTYYVQFYHSKKKHKFVSPILKSGTIEQNANSSLEGSSYKQDQVRRNLISEIESSSRYKDMETISTIQGHQRENMKHIIGGLSNKRKGNDSPSVSDLEDKSNKKMHLSSIKETNVGNELSLRKCIRTSMEAVDVTSCNTPRRQIVKLATEESPQSMQGSSIVSPGDAFWKEALQVFDEMSNHNKHLYEHVEEPKGSGQFEINHINDVSNQSNDNRSCNTPSVDIKSCDVDILKSVESISSSC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G254990`
TK1151 ID	TkA01G254990
OH-1004 ID	LXL04_033936
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	98.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G254990

Location Chr01:64310980-64312685 (-)

Description Similar to TEB: Helicase and polymerase-containing protein TEBICHI

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g32700`	Required for regulated cell division and differentiation in meristems and embryos, thus modulating adaxial-abaxial polarity.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033936 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0000731 DNA synthesis involved in DNA repair Biological Process

GO:0006261 DNA-templated DNA replication Biological Process

GO:0006281 DNA repair Biological Process

GO:0006284 base-excision repair Biological Process

GO:0006302 double-strand break repair Biological Process

GO:0006974 DNA damage response Biological Process

GO:0009640 photomorphogenesis Biological Process

GO:0009933 meristem structural organization Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0010792 DNA double-strand break processing involved in repair via single-strand annealing Biological Process

GO:0031297 replication fork processing Biological Process

KEGG gene cross-reference

ath:AT4G32700

dme:Dmel_CG6019

hsa:10721

hsa:113510

mmu:77782

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.905

Rank 1 · TkA01G254990 · TK1151

Cytoplasm0.156

Rank 2 · TkA01G254990 · TK1151

Cell membrane0.037

Rank 3 · TkA01G254990 · TK1151

Endoplasmic reticulum0.021

Rank 4 · TkA01G254990 · TK1151

Mitochondrion0.016

Rank 5 · TkA01G254990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00270DEAD301-382 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G254990	`PF00270`	DEAD	301	382	7.7e-11	42.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q588V7`	Arabidopsis thaliana	sp\|Q588V7\|TEB_ARATH Helicase and polymerase-containing protein TEBICHI	70.400%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card