TkA01G220980 | RubberDandelionOmics

Gene overview

TkA01G220980

Reference: TK1151 Chr: Chr01 Coordinates: 56235625-56237383 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

750 bp · TkA01G220980|TK1151|cDNA

ATGCTCTCAACTGTGAAGACCATTACTTATGAATCATTAAGTAACATACTACGGCTTATCAATGGAATATCCGCACTATTGCTATCTATATTACCTGGCAAAGCCAGTATTCTTGAAGGATTGCAAGGTTGGGAGCTCAAACCAAAAGTACGTGGCCCTCAATTGCCACGTTGGATGGAAGAGAGGAACACCCTGACCAAAATTCCTGGCTCCGTCCCTGACAACAACAGATCTGAACATCGTGTTCGTATCGGCTGTAG...

CDS

Download CDS FASTA

750 bp · TkA01G220980|TK1151|CDS

ATGCTCTCAACTGTGAAGACCATTACTTATGAATCATTAAGTAACATACTACGGCTTATCAATGGAATATCCGCACTATTGCTATCTATATTACCTGGCAAAGCCAGTATTCTTGAAGGATTGCAAGGTTGGGAGCTCAAACCAAAAGTACGTGGCCCTCAATTGCCACGTTGGATGGAAGAGAGGAACACCCTGACCAAAATTCCTGGCTCCGTCCCTGACAACAACAGATCTGAACATCGTGTTCGTATCGGCTGTAG...

Protein

Download Protein FASTA

249 aa · TkA01G220980|TK1151|PROTEIN

MLSTVKTITYESLSNILRLINGISALLLSILPGKASILEGLQGWELKPKVRGPQLPRWMEERNTLTKIPGSVPDNNRSEHRVRIGCRIKKKKKTNSEMESQASLLHLEVGHVDDSSLVEVDGGDFGCSHYRRKCKIKTPCCDEIFDCRHCHNEVKNSLDIDPLNRHDVPRHEVKKVICSLCETEQDVQQNCINCGVTMGKYFCQKCNSSMMMFPRISTTVINVAYVEQEAKRISFTVTNVCMILLHVFI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G220980`
TK1151 ID	TkA01G220980
OH-1004 ID	LXL04_025855
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	66.300
Protein coverage (%)	TK1151 33.333 / OH-1004 30.182 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G220980

Location Chr01:56235625-56237383 (-)

Description Similar to RZFP34: Probable E3 ubiquitin-protein ligase RZFP34

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g22920`	Possesses E3 ubiquitin-protein ligase activity in vitro.	Expression of a gene encoding a rice RING zinc-finger protein, OsRZFP34, enhances stomata opening.2014 · DOI: 10.1007/s11103-014-0217-6 Arabidopsis RZFP34/CHYR1, a Ubiquitin E3 Ligase, Regulates Stomatal Movement and Drought Tolerance via SnRK2.6-Mediated Phosphorylation.2015 · DOI: 10.1105/tpc.15.00321
`At5g18650`	E3 ubiquitin-protein ligase that acts as a regulator of cell death and defense.	Arabidopsis ubiquitin ligase MIEL1 mediates degradation of the transcription factor MYB30 weakening plant defence.2013 · DOI: 10.1038/ncomms2479
`At3g18290`	Essential protein.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0719100`	Possesses transactivation activity in yeast cells (Ref.1).	Expression of a gene encoding a rice RING zinc-finger protein, OsRZFP34, enhances stomata opening.2014 · DOI: 10.1007/s11103-014-0217-6
`Os03g0348900`	Possesses E3 ubiquitin-protein ligase activity in vitro.	Knock-down of stress inducible OsSRFP1 encoding an E3 ubiquitin ligase with transcriptional activation activity confers abiotic stress tolerance through enhancing antioxidant protection in rice.2015 · DOI: 10.1007/s11103-015-0294-1

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025855 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0006952 defense response Biological Process

GO:0010255 glucose mediated signaling pathway Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0031398 positive regulation of protein ubiquitination Biological Process

GO:0032436 positive regulation of proteasomal ubiquitin-dependent protein catabolic process Biological Process

GO:0051865 protein autoubiquitination Biological Process

GO:0072344 rescue of stalled cytosolic ribosome Biological Process

GO:1900425 negative regulation of defense response to bacterium Biological Process

GO:1902456 regulation of stomatal opening Biological Process

GO:0000151 ubiquitin ligase complex Cellular Component

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT5G18650

ath:AT5G22920

dosa:Os01g0719100

dosa:Os03g0348900

mmu:68098

osa:4324695

osa:4332833

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.428

Rank 1 · TkA01G220980 · TK1151

Nucleus0.398

Rank 2 · TkA01G220980 · TK1151

Mitochondrion0.141

Rank 3 · TkA01G220980 · TK1151

Cell membrane0.089

Rank 4 · TkA01G220980 · TK1151

Endoplasmic reticulum0.081

Rank 5 · TkA01G220980 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28430Ig_LY6G6F24-98 aa

PF05495zf-CHY127-201 aa

PF05495zf-CHY203-210 aa

PF28430Ig_LY6G6F225-238 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G220980	`PF28430`	Ig_LY6G6F	24	98	0.055	14.1
TkA01G220980	`PF05495`	zf-CHY	127	201	1.2e-19	71.2
TkA01G220980	`PF05495`	zf-CHY	203	210	1.2e-19	71.2
TkA01G220980	`PF28430`	Ig_LY6G6F	225	238	0.055	14.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FFB6`	Arabidopsis thaliana	sp\|Q9FFB6\|ZFP34_ARATH E3 ubiquitin-protein ligase RZFP34	73.900%	Swiss-Prot	Low
`Q8VZK0`	Arabidopsis thaliana	sp\|Q8VZK0\|MIEL1_ARATH E3 ubiquitin-protein ligase MIEL1	58.500%	Swiss-Prot	Low
`Q8LPQ5`	Arabidopsis thaliana	sp\|Q8LPQ5\|BTS_ARATH Zinc finger protein BRUTUS	35.300%	Swiss-Prot	Low
`Q5JL96`	Oryza sativa subsp. japonica	sp\|Q5JL96\|ZFP34_ORYSJ Probable E3 ubiquitin-protein ligase RZFP34	63.800%	Swiss-Prot	Low
`Q10LI1`	Oryza sativa subsp. japonica	sp\|Q10LI1\|SRFP1_ORYSJ E3 ubiquitin-protein ligase SRFP1	49.500%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card