TkA01G212510 | RubberDandelionOmics

Gene overview

TkA01G212510

Reference: TK1151 Chr: Chr01 Coordinates: 54155172-54157379 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1044 bp · TkA01G212510|TK1151|cDNA

ATGCTCATCGCGAGTTACGAGAGAGGAGGGTCACGGTGGAATAAGGCAGCAGCTAGGTCAAAGAAAAGAAAACCACCGGAGTTAGGTGGGTACGCCGGTGAGAATTTTTCCGGCTGTTCTGGACGTCGACTAACACCAGGTTTGAAGCACCACCCATCTATCTTTCCTAGATGGGTGTGGGGTTTACGACCAAAGGAGGTCATCGGCAACGAGCTCGTGGCAGTGAGAACTCCGTTTTTGATGGGCGTTTCTTCTTCTTC...

CDS

Download CDS FASTA

1044 bp · TkA01G212510|TK1151|CDS

ATGCTCATCGCGAGTTACGAGAGAGGAGGGTCACGGTGGAATAAGGCAGCAGCTAGGTCAAAGAAAAGAAAACCACCGGAGTTAGGTGGGTACGCCGGTGAGAATTTTTCCGGCTGTTCTGGACGTCGACTAACACCAGGTTTGAAGCACCACCCATCTATCTTTCCTAGATGGGTGTGGGGTTTACGACCAAAGGAGGTCATCGGCAACGAGCTCGTGGCAGTGAGAACTCCGTTTTTGATGGGCGTTTCTTCTTCTTC...

Protein

Download Protein FASTA

347 aa · TkA01G212510|TK1151|PROTEIN

MLIASYERGGSRWNKAAARSKKRKPPELGGYAGENFSGCSGRRLTPGLKHHPSIFPRWVWGLRPKEVIGNELVAVRTPFLMGVSSSSPDNTTGHYHLLILFLIPILSSLLSFSVFDCLFRKVCLSLHSLLIQSDSEQQGRVLGISTAVLGCLSSRSLEVPSFLKGPQLTKKIWALASYRDYTFAAYGNEIGVFKRAHQVATWTKHNAKVNLLLFGDHILSVDIEGIFIWAFKGADENPSPIGHILLDNEFTPSCIMHPDT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G212510`
TK1151 ID	TkA01G212510
OH-1004 ID	LXL04_004332
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	93.300
Protein coverage (%)	TK1151 38.329 / OH-1004 15.118 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G212510`
Location	Chr01:54155172-54157379 (+)
Description	Similar to SPCC1672.07: U3 small nucleolar RNA-associated protein 21 homolog (Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_004332` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006364 rRNA processing Biological Process GO:0006508 proteolysis Biological Process GO:0030490 maturation of SSU-rRNA Biological Process GO:0042274 ribosomal small subunit biogenesis Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005730 nucleolus Cellular Component GO:0005829 cytosol Cellular Component GO:0030686 90S preribosome Cellular Component GO:0032040 small-subunit processome Cellular Component GO:0032153 cell division site Cellular Component GO:0034388 Pwp2p-containing subcomplex of 90S preribosome Cellular Component
KEGG gene cross-reference	ana:all2124 hsa:134430 sce:YLR409C spo:2539299 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.405

Rank 1 · TkA01G212510 · TK1151

Cytoplasm0.359

Rank 2 · TkA01G212510 · TK1151

Cell membrane0.143

Rank 3 · TkA01G212510 · TK1151

Endoplasmic reticulum0.127

Rank 4 · TkA01G212510 · TK1151

Mitochondrion0.108

Rank 5 · TkA01G212510 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25171Beta-prop_WDR36-Utp21_1st165-295 aa

PF24814WD40_Prp19189-217 aa

PF25047Beta-prop_TEP1_2nd195-235 aa

PF23381Beta-prop_IFT122_1st205-301 aa

PF24814WD40_Prp19256-293 aa

PF25173Beta-prop_WDR3_1st261-295 aa

PF25047Beta-prop_TEP1_2nd265-298 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G212510	`PF25171`	Beta-prop_WDR36-Utp21_1st	165	295	1.4e-32	113.9
TkA01G212510	`PF24814`	WD40_Prp19	189	217	0.015	15.1
TkA01G212510	`PF25047`	Beta-prop_TEP1_2nd	195	235	0.00018	21.5
TkA01G212510	`PF23381`	Beta-prop_IFT122_1st	205	301	0.14	12.2
TkA01G212510	`PF24814`	WD40_Prp19	256	293	0.015	15.1
TkA01G212510	`PF25173`	Beta-prop_WDR3_1st	261	295	0.028	14.9
TkA01G212510	`PF25047`	Beta-prop_TEP1_2nd	265	298	0.00018	21.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card