TkA01G180940 | RubberDandelionOmics

Gene overview

TkA01G180940

Reference: TK1151 Chr: Chr01 Coordinates: 46411473-46412303 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

831 bp · TkA01G180940|TK1151|cDNA

ATGGAATTGAACTTTCAAAGCAATTATGGGTTCTCATCTTCATCTTCATCTTCATCGTCTTCCAAGAAAGGCCGATTCAGTGGCACAAACGGCCGGAATTCCAGTAGAAACAAGTTTGTTGGTGTTAGACAGCGGCCGTCCGGTAAATGGGTGGCGGAAATAAAAAACACCACTCAGAAAATCCGGATGTGGTTAGGGACTTTCGACACGGCGGAGGAAGCTGCCAGGGCGTACGACGAGGCGGCGTATTTGCTCCGGGG...

CDS

Download CDS FASTA

831 bp · TkA01G180940|TK1151|CDS

ATGGAATTGAACTTTCAAAGCAATTATGGGTTCTCATCTTCATCTTCATCTTCATCGTCTTCCAAGAAAGGCCGATTCAGTGGCACAAACGGCCGGAATTCCAGTAGAAACAAGTTTGTTGGTGTTAGACAGCGGCCGTCCGGTAAATGGGTGGCGGAAATAAAAAACACCACTCAGAAAATCCGGATGTGGTTAGGGACTTTCGACACGGCGGAGGAAGCTGCCAGGGCGTACGACGAGGCGGCGTATTTGCTCCGGGG...

Protein

Download Protein FASTA

276 aa · TkA01G180940|TK1151|PROTEIN

MELNFQSNYGFSSSSSSSSSSKKGRFSGTNGRNSSRNKFVGVRQRPSGKWVAEIKNTTQKIRMWLGTFDTAEEAARAYDEAAYLLRGANARTNFIHHVPINSALSLKIRNLLNHKKCLRQNAIAKNTTTTTPAAPPRPSVTCTVQVNNTKKENFSSGYQGIEVFDDGYKPDLTNCIGGVEIGDAGGGFCYEFQSDLPLTIGGEFEGFNLAPITKKGDEDGESTSDFERMKVERQISASLYAMNGVNEYWDNVLQDCSDGG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G180940`
TK1151 ID	TkA01G180940
OH-1004 ID	LXL04_004246
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G180940

Location Chr01:46411473-46412303 (-)

Description Similar to ERN1: Ethylene-responsive transcription factor ERN1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g19790`	Probably acts as a transcriptional activator.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004246 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000302 response to reactive oxygen species Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009723 response to ethylene Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0009877 nodulation Biological Process

GO:0035865 cellular response to potassium ion Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0048528 post-embryonic root development Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

KEGG gene cross-reference

ath:AT5G19790

mtr:11417172

mtr:11437275

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.970

Rank 1 · TkA01G180940 · TK1151

Cytoplasm0.083

Rank 2 · TkA01G180940 · TK1151

Cell membrane0.027

Rank 3 · TkA01G180940 · TK1151

Endoplasmic reticulum0.022

Rank 4 · TkA01G180940 · TK1151

Plastid0.018

Rank 5 · TkA01G180940 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00847AP238-87 aa

PF26003Integrase_N_phage41-76 aa

PF14112DUF428461-101 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G180940	`PF00847`	AP2	38	87	6.4e-15	55.9
TkA01G180940	`PF26003`	Integrase_N_phage	41	76	0.18	12.6
TkA01G180940	`PF14112`	DUF4284	61	101	0.21	13.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6J9S1`	Arabidopsis thaliana	sp\|Q6J9S1\|RA211_ARATH Ethylene-responsive transcription factor RAP2-11	45.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card