TkA01G176170 | RubberDandelionOmics

Gene overview

TkA01G176170

Reference: TK1151 Chr: Chr01 Coordinates: 45171440-45172357 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

918 bp · TkA01G176170|TK1151|cDNA

ATGTGCATACAACTCAGGGGCAAAAGAGAAATTGTGAGGATGGTGGAAATGCAAGTGGACCCGTTAGACCCACCGAAATTCAAACACAAGAGAATCCCGAGAGCTAACGTTAACGGGTCGCCACTCATGCACTCGCCACCTAGACCTGTGACAGTGAAAGACCAAGAAGCTTGGAGGATCCCTCAATGTATTTCAAACTGGAAAAATCCAAAAGGGTATACAATTCCATTAGATAAACGGCTAGCAGCCGATGGTACTAG...

CDS

Download CDS FASTA

918 bp · TkA01G176170|TK1151|CDS

ATGTGCATACAACTCAGGGGCAAAAGAGAAATTGTGAGGATGGTGGAAATGCAAGTGGACCCGTTAGACCCACCGAAATTCAAACACAAGAGAATCCCGAGAGCTAACGTTAACGGGTCGCCACTCATGCACTCGCCACCTAGACCTGTGACAGTGAAAGACCAAGAAGCTTGGAGGATCCCTCAATGTATTTCAAACTGGAAAAATCCAAAAGGGTATACAATTCCATTAGATAAACGGCTAGCAGCCGATGGTACTAG...

Protein

Download Protein FASTA

305 aa · TkA01G176170|TK1151|PROTEIN

MCIQLRGKREIVRMVEMQVDPLDPPKFKHKRIPRANVNGSPLMHSPPRPVTVKDQEAWRIPQCISNWKNPKGYTIPLDKRLAADGTRGLQQVQINDNFVKLSEALYVGEEKAREAVTMRSKVQKKIMVKEKEKKEEELRVLAQKARSERAAEGGHSGKGMMREKIRERRLEAKDGGMGKKRKITRDMSEKVALGMASACGGEVMYDQRLFNQENGMASGFGNGDEYNVYDKRLFATTLSTLYRRPKTDKGFTGCGHERSG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G176170`
TK1151 ID	TkA01G176170
OH-1004 ID	LXL04_004268
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G176170

Location Chr01:45171440-45172357 (+)

Description Similar to SKIP: SNW/SKI-interacting protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g77180`	Splicing factor involved in post-transcriptional regulation of circadian clock and flowering time genes.	A putative novel transcription factor, AtSKIP, is involved in abscisic acid signalling and confers salt and osmotic tolerance in Arabidopsis.2010 · DOI: 10.1111/j.1469-8137.2009.03032.x SKIP is a component of the spliceosome linking alternative splicing and the circadian clock in Arabidopsis.2012 · DOI: 10.1105/tpc.112.100081

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0759800`	Acts as a positive regulator of drought and salt tolerance.	A homolog of human ski-interacting protein in rice positively regulates cell viability and stress tolerance.2009 · DOI: 10.1073/pnas.0901940106

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004268 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0008380 RNA splicing Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0010228 vegetative to reproductive phase transition of meristem Biological Process

GO:0010555 response to mannitol Biological Process

GO:0042752 regulation of circadian rhythm Biological Process

GO:0043923 host-mediated activation of viral transcription Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

KEGG gene cross-reference

ath:AT1G77180

dme:Dmel_CG8264

dosa:Os02g0759800

hsa:22938

osa:4330796

pon:100174597

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.949

Rank 1 · TkA01G176170 · TK1151

Cytoplasm0.155

Rank 2 · TkA01G176170 · TK1151

Mitochondrion0.017

Rank 3 · TkA01G176170 · TK1151

Cell membrane0.016

Rank 4 · TkA01G176170 · TK1151

Endoplasmic reticulum0.008

Rank 5 · TkA01G176170 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02731SKIP_SNW7-149 aa

PF02731SKIP_SNW260-274 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G176170	`PF02731`	SKIP_SNW	7	149	1.7e-60	204.0
TkA01G176170	`PF02731`	SKIP_SNW	260	274	1.7e-60	204.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O80653`	Arabidopsis thaliana	sp\|O80653\|SKIP_ARATH SNW/SKI-interacting protein	54.400%	Swiss-Prot	High
`Q6K8D9`	Oryza sativa subsp. japonica	sp\|Q6K8D9\|SKIPA_ORYSJ SNW/SKI-interacting protein A	52.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card