TkA01G175340 | RubberDandelionOmics

Gene overview

TkA01G175340

Reference: TK1151 Chr: Chr01 Coordinates: 44970876-44972666 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1703 bp · TkA01G175340|TK1151|cDNA

CGGGTTGAAGTCTATTATAGAGACTTGCATTGCTCAAAATAGGTAGAGACACTCGATGGCCGTTTCAAAAAAAAGGTGGTGAAGGATGATTGAGTAATCACAGTGGGCCACTTCTGCGCGCAGATTCCGTTCTATCAAACTGCATTTGTGCAACGTCCTCTTTCCCTGCCGCTCTCCGGCCACTTTTCTCTTTCTCGCCGCCACCCCAAGCACGGTGTCCCGCTGCCGCCACCGACCTCTGCTCTCAGTCTCAGTGCACA...

CDS

Download CDS FASTA

1050 bp · TkA01G175340|TK1151|CDS

ATGGAGAACCTCCCCGACGATGTTTTATCAGACATATTCATCCGGTTACGGGCAAAACAGATTGCTCAAATGAGGTGCATCTCTAAATACTGGAACGCTCACTTTTCTCAATCTTCCTTCATAAAATCCCATTTGGATCGTTCAATCCATAACAAGGATAGAATTCTCTTGGTCTTCTCAACCGCAGATCCTTTTAACCTTGAACAATTCACAATACGCCCCTATATCAAACTCCCCAATGTCATCAAACTCCCGGTTGA...

Protein

Download Protein FASTA

349 aa · TkA01G175340|TK1151|PROTEIN

MENLPDDVLSDIFIRLRAKQIAQMRCISKYWNAHFSQSSFIKSHLDRSIHNKDRILLVFSTADPFNLEQFTIRPYIKLPNVIKLPVDTQFRDFTGEVIGSVNGLICFKYGPTPDSQTIYIWNPSLSALLTVPPYSLPHLVDKYIQFHYFRFGYDPKTDDYKVFKHTEGFKYPIREYGYGYNLRVCETFPLKNWVQFEVYSMRKGSWKVINRKIPSHLKLAYRPHHLCLDEYHPHLHWLGKNETGQVIVAFDLSTETFREI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G175340`
TK1151 ID	TkA01G175340
OH-1004 ID	LXL04_004275
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.100
Protein coverage (%)	TK1151 89.971 / OH-1004 81.771 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G175340

Location Chr01:44970876-44972666 (-)

Description Similar to CPR1: F-box protein CPR1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g47030`	F-box protein At3g47030.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004275 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0008284 positive regulation of cell population proliferation Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0031348 negative regulation of defense response Biological Process

GO:0042177 negative regulation of protein catabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009506 plasmodesma Cellular Component

KEGG gene cross-reference

ath:AT3G06240

ath:AT3G07870

ath:AT3G10240

ath:AT4G12560

ath:AT4G22390

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.682

Rank 1 · TkA01G175340 · TK1151

Nucleus0.381

Rank 2 · TkA01G175340 · TK1151

Endoplasmic reticulum0.080

Rank 3 · TkA01G175340 · TK1151

Cell membrane0.067

Rank 4 · TkA01G175340 · TK1151

Mitochondrion0.044

Rank 5 · TkA01G175340 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646F-box2-40 aa

PF12937F-box-like2-38 aa

PF08268FBA_358-315 aa

PF07734FBA_192-310 aa

PF24750b-prop_At3g26010-like191-265 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G175340	`PF00646`	F-box	2	40	3.9e-06	27.3
TkA01G175340	`PF12937`	F-box-like	2	38	8.1e-06	26.2
TkA01G175340	`PF08268`	FBA_3	58	315	3.5e-21	76.3
TkA01G175340	`PF07734`	FBA_1	92	310	5e-16	59.3
TkA01G175340	`PF24750`	b-prop_At3g26010-like	191	265	0.028	14.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SD70`	Arabidopsis thaliana	sp\|Q9SD70\|FB195_ARATH F-box protein At3g47030	22.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card