RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G154810
Reference: TK1151 Chr: Chr01 Coordinates: 39257162-39259777 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1373 bp · TkA01G154810|TK1151|cDNA

TTACTTTGCATTGTGATCGAACGACTGAATGATTATGTGATCTAAGTTTTTGATCGGAAATGAACGAAAGTTAAAGTAAAAAGAGACTCTTTGGTTAATTTTACGTTTCTGTTCTGTTGTATATTTCCGATTGTTTAAAGCAATTGTATTTCGTGGAGTTTCTGCAACAAATAATCTCGAATTAAGTAGCGGAAATTAGGATTTGCCTCGACTCCTATTGATCACTGAAGATTAAGGATGATGGAAAAATCGACTTCAAC...

CDS

Download CDS FASTA

759 bp · TkA01G154810|TK1151|CDS

ATGAACTGGCACCTACAAACTGAATTCAACATCCCCCATAGCTTTATGGATTTCTTTGAAGGACTCACATATGAGCATGTCAATTTCATTTTTTCCGACGTCACATATCCTCAGGATAGCACAAACTATACAATGAATACGAGTTCATATAAGTTTGCATACTCTGAACAGGGGAATTTCTCATACTACGATTATTTTAATGCGTATGCAATAAATGATCCGATATATGGCAACAGTGGATTTACTAGACAACTAGAAAA...

Protein

Download Protein FASTA

252 aa · TkA01G154810|TK1151|PROTEIN

MNWHLQTEFNIPHSFMDFFEGLTYEHVNFIFSDVTYPQDSTNYTMNTSSYKFAYSEQGNFSYYDYFNAYAINDPIYGNSGFTRQLENTPTMANERSTPVHIQQDRHSTSNSHTNPSNCPQSNHNHNPNQNPGDYHQVMWEDNVDLDNMSYEELLELGEVVGSQSRGLSHEAISLLPVSKFKCGFFWRKKSKSERCVICQMEYKRGERQVTLPCKHIYHAGCGSQWLSINKACPICYKEVVINIPKHSEKVSK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G154810
TK1151 IDTkA01G154810
OH-1004 IDLXL04_004430
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)98.400
Protein coverage (%)TK1151 98.810 / OH-1004 99.203
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G154810
LocationChr01:39257162-39259777 (-)
DescriptionSimilar to BB: E3 ubiquitin-protein ligase BIG BROTHER
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g63530 E3 ubiquitin-protein ligase that limits organ size, and possibly seed size, in a dose-dependent manner.
Forever Young: The Role of Ubiquitin Receptor DA1 and E3 Ligase BIG BROTHER in Controlling Leaf Growth and Development.2017 · DOI: 10.1104/pp.16.01410
At3g19910 E3 ubiquitin-ligase probably involved in organ size regulation. No verified direct reference in this release
At4g34040 E3 ubiquitin-protein ligase that functions as a regulator of MED25 stability by targeting MED25 for degradation in a RING-H2- dependent way.
Proteasome-mediated turnover of Arabidopsis MED25 is coupled to the activation of FLOWERING LOCUS T transcription.2012 · DOI: 10.1104/pp.112.205500
At2g15530 E3 ubiquitin-protein ligase that functions as a regulator of MED25 stability by targeting MED25 for degradation in a RING-H2- dependent way.
Proteasome-mediated turnover of Arabidopsis MED25 is coupled to the activation of FLOWERING LOCUS T transcription.2012 · DOI: 10.1104/pp.112.205500

Rice

Reference gene IDPossible functionPapers / DOI
Os04g0648800 Probable E3 ubiquitin-protein ligase that functions downstream of HAL3 and is required for HAL3-regulated plant growth. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_004430 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0008285 negative regulation of cell population proliferation Biological Process
GO:0009845 seed germination Biological Process
GO:0009908 flower development Biological Process
GO:0010218 response to far red light Biological Process
GO:0010228 vegetative to reproductive phase transition of meristem Biological Process
GO:0016567 protein ubiquitination Biological Process
GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process
GO:0046621 negative regulation of organ growth Biological Process
GO:0048437 floral organ development Biological Process
GO:0051865 protein autoubiquitination Biological Process
GO:1900057 positive regulation of leaf senescence Biological Process
GO:0005634 nucleus Cellular Component
KEGG gene cross-reference
ath:AT2G15530
ath:AT3G19910
ath:AT3G63530
ath:AT4G34040
dosa:Os04g0648800
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.515
Rank 1 · TkA01G154810 · TK1151
Nucleus0.481
Rank 2 · TkA01G154810 · TK1151
Cell membrane0.087
Rank 3 · TkA01G154810 · TK1151
Endoplasmic reticulum0.073
Rank 4 · TkA01G154810 · TK1151
Lysosome / Vacuole0.065
Rank 5 · TkA01G154810 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17486Cys_Knot_tox36-48 aa
PF14447Prok-RING_4112-123 aa
PF00097zf-C3HC4113-119 aa
PF12678zf-rbx1117-118 aa
PF17122zf-C3H2C3176-185 aa
PF23555zf-RING_Vps41177-184 aa
PF17486Cys_Knot_tox181-201 aa
PF29452FAR1_N188-235 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA01G154810PF17486Cys_Knot_tox36480.1812.8
TkA01G154810PF14447Prok-RING_41121230.001519.1
TkA01G154810PF00097zf-C3HC41131191.5e-0525.5
TkA01G154810PF12678zf-rbx11171185.4e-0730.5
TkA01G154810PF17122zf-C3H2C31761850.0215.6
TkA01G154810PF23555zf-RING_Vps411771843.48.1
TkA01G154810PF17486Cys_Knot_tox1812010.1812.8
TkA01G154810PF29452FAR1_N1882350.05214.3
TkA01G154810PF12678zf-rbx11912355.4e-0730.5
TkA01G154810PF13920zf-C3HC4_31922394.2e-0524.0
TkA01G154810PF17120zf-RING_161922335.8e-0523.3
TkA01G154810PF13639zf-RING_21942358.3e-1349.1
TkA01G154810PF13923zf-C3HC4_21942352.1e-0731.3
TkA01G154810PF14634zf-RING_51942360.0002421.7
TkA01G154810PF17123zf-RING_111952219.7e-0729.1
TkA01G154810PF00097zf-C3HC41952351.5e-0525.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q8L649Arabidopsis thalianasp|Q8L649|BB_ARATH E3 ubiquitin-protein ligase BIG BROTHER41.000%Swiss-ProtMedium
Q9LT17Arabidopsis thalianasp|Q9LT17|BBR_ARATH E3 ubiquitin ligase BIG BROTHER-related48.100%Swiss-ProtLow
O49500Arabidopsis thalianasp|O49500|MBR2_ARATH E3 ubiquitin-protein ligase MBR243.000%Swiss-ProtLow
Q9ZQF9Arabidopsis thalianasp|Q9ZQF9|MBR1_ARATH E3 ubiquitin-protein ligase MBR142.200%Swiss-ProtLow
Q7XTV7Oryza sativa subsp. japonicasp|Q7XTV7|HIP1_ORYSJ Probable E3 ubiquitin-protein ligase HIP147.900%Swiss-ProtLow

JBrowse

View in Genome Browser