TkA01G136710 | RubberDandelionOmics

Gene overview

TkA01G136710

Reference: TK1151 Chr: Chr01 Coordinates: 34705636-34708897 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2187 bp · TkA01G136710|TK1151|cDNA

CTCAAACCCTCAAACTTTTGAGGCGTCGTCTTCCCTTTTCTCTCTTCACACCGACTCCATCTACCTATCGGCCGGTGATTCTTTTCGCGGAGGCTAGGCTTTCAAAATCTCGACCAATCTTTAGATCTTTCACTTTCCGATCTCAAGATGGTGTCTGATGCGAGCAAAAAGAAGGCGCTCCAGTTCGGATAACTTGTCCAATGGGATGGGGTCGCTTGTGATTTCTGACCGTACATGTACCGGCGTTCTTTGCTCTCATC...

CDS

Download CDS FASTA

1521 bp · TkA01G136710|TK1151|CDS

CAAACCCTCAAACTTTTGAGGCGTCGTCTTCCCTTTTCTCTCTTCACACCGACTCCATCTACCTATCGGCCGGTGATTCTTTTCGCGGAGGCTAGGCTTTCAAAATCTCGACCAATCTTTAGATCTTTCACTTTCCGATCTCAAGGTACCGATCTGATCGAATATCGTGTTTTTAGGATGGTGTCTGATGCGAGCAAAAAGAAGGCGCTCCAGAAGAAGGCAGCAGCCGCTGCCAAGAGAGGAGGTAAGGCAGCCGCCGC...

Protein

Download Protein FASTA

506 aa · TkA01G136710|TK1151|PROTEIN

QTLKLLRRRLPFSLFTPTPSTYRPVILFAEARLSKSRPIFRSFTFRSQGTDLIEYRVFRMVSDASKKKALQKKAAAAAKRGGKAAAAATSAKAAAIGTMNGSTSSDNLSNGMGSLVISDRTCTGVLCSHPLSRDIRIESLSLTFHGHDLIVDTELELNYGRRYGLLGLNGCGKSTLLTSIGMRELPIPEHMDIFHLTREIEASDMSSLEAVMNCDEERLKLEAEVERLAALDAGGGEALDRIYERLDAMDASTAEKRAAE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G136710`
TK1151 ID	TkA01G136710
OH-1004 ID	LXL04_004539
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.400
Protein coverage (%)	TK1151 87.549 / OH-1004 72.862 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G136710

Location Chr01:34705636-34708897 (+)

Description Similar to ABCF1: ABC transporter F family member 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g60790`	ABC transporter F family member 1.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004539 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000056 ribosomal small subunit export from nucleus Biological Process

GO:0006515 protein quality control for misfolded or incompletely synthesized proteins Biological Process

GO:0042254 ribosome biogenesis Biological Process

GO:0043335 protein unfolding Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009536 plastid Cellular Component

GO:0016020 membrane Cellular Component

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT5G60790

bta:513061

hsa:10061

hsa:114483834

mmu:27407

sce:YER036C

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.515

Rank 1 · TkA01G136710 · TK1151

Nucleus0.301

Rank 2 · TkA01G136710 · TK1151

Plastid0.119

Rank 3 · TkA01G136710 · TK1151

Mitochondrion0.111

Rank 4 · TkA01G136710 · TK1151

Peroxisome0.077

Rank 5 · TkA01G136710 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13514AAA_27136-181 aa

PF00005ABC_tran153-307 aa

PF13479AAA_24161-214 aa

PF03308MeaB161-182 aa

PF13555AAA_29162-177 aa

PF03193RsgA_GTPase162-180 aa

PF01926MMR_HSR1163-203 aa

PF13304AAA_21164-248 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G136710	`PF13514`	AAA_27	136	181	0.0078	16.5
TkA01G136710	`PF00005`	ABC_tran	153	307	1.9e-29	103.7
TkA01G136710	`PF13479`	AAA_24	161	214	0.003	18.0
TkA01G136710	`PF03308`	MeaB	161	182	0.093	12.4
TkA01G136710	`PF13555`	AAA_29	162	177	9.6e-06	26.0
TkA01G136710	`PF03193`	RsgA_GTPase	162	180	0.023	15.2
TkA01G136710	`PF01926`	MMR_HSR1	163	203	0.016	16.1
TkA01G136710	`PF13304`	AAA_21	164	248	6.2e-11	43.5
TkA01G136710	`PF02463`	SMC_N	164	349	1.5e-06	28.6
TkA01G136710	`PF13173`	AAA_14	164	196	0.0053	17.5
TkA01G136710	`PF00931`	NB-ARC	164	194	0.028	14.7
TkA01G136710	`PF05729`	NACHT	165	180	0.021	15.4
TkA01G136710	`PF13521`	AAA_28	165	229	0.022	15.7
TkA01G136710	`PF13481`	AAA_25	165	180	0.11	12.9
TkA01G136710	`PF19263`	DUF5906	165	182	0.16	13.4
TkA01G136710	`PF00004`	AAA	165	181	0.18	12.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FJH6`	Arabidopsis thaliana	sp\|Q9FJH6\|AB1F_ARATH ABC transporter F family member 1	81.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card