Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1290 bp · TkA01G132090|TK1151|cDNA
ATGTTTGAGAAGATTACTAACCTTGATGATGCCCTTATACTGCTCGATGAAATGACACAGAGACAACCTCCGTCATCAGTTGTTAAATTCAACCAGTTGTTGCAAGCTGTTACTAAAATGAAACACTTTGCTTCTGCTTCTGAGTTTGTGAGAGATGGATCGTTTAAATGGCTGTTGAAGAATCCAAGTCCATTTCATGAAGAGTTTGAGCAGATGAAAATGTCTCCATCTGCTGACAAAAACTGGATACATGAGCTCTC...
1290 bp · TkA01G132090|TK1151|CDS
ATGTTTGAGAAGATTACTAACCTTGATGATGCCCTTATACTGCTCGATGAAATGACACAGAGACAACCTCCGTCATCAGTTGTTAAATTCAACCAGTTGTTGCAAGCTGTTACTAAAATGAAACACTTTGCTTCTGCTTCTGAGTTTGTGAGAGATGGATCGTTTAAATGGCTGTTGAAGAATCCAAGTCCATTTCATGAAGAGTTTGAGCAGATGAAAATGTCTCCATCTGCTGACAAAAACTGGATACATGAGCTCTC...
Protein
Download Protein FASTA429 aa · TkA01G132090|TK1151|PROTEIN
MFEKITNLDDALILLDEMTQRQPPSSVVKFNQLLQAVTKMKHFASASEFVRDGSFKWLLKNPSPFHEEFEQMKMSPSADKNWIHELSPVANIVVRRCSKILEISTGELQEKFNGEAPDVIKEASVYARNFLEYYVSGLFIIIPTPSTRSGVAALASSLSLSVNGHTAPRCLAMDSLWLHALTWCVCSVCDSFTQRPDARGMLGFTPIQKCTAALRMLAYGTHPDSLDENFRMSERTARDTLIHFCDRILQLYAPRYLRTP...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA01G132090 |
|---|---|
| TK1151 ID | TkA01G132090 |
| OH-1004 ID | LXL04_014751 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 94.500 |
| Protein coverage (%) | TK1151 29.604 / OH-1004 22.281Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA01G132090 |
|---|---|
| Location | Chr01:33453244-33457275 (+) |
| Description | Similar to MKK6: Mitogen-activated protein kinase kinase 6 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0002229 defense response to oomycetes Biological Process GO:0006952 defense response Biological Process GO:0007112 male meiosis cytokinesis Biological Process GO:0007165 signal transduction Biological Process GO:0010200 response to chitin Biological Process GO:0010311 lateral root formation Biological Process GO:0051707 response to other organism Biological Process GO:0009507 chloroplast Cellular Component GO:0009524 phragmoplast Cellular Component GO:0004674 protein serine/threonine kinase activity Molecular Function GO:0004708 MAP kinase kinase activity Molecular Function GO:0004713 protein tyrosine kinase activity Molecular Function |
| KEGG gene cross-reference | ath:AT5G56580 dosa:Os01g0510100 nta:107818847 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF04827Plant_tran260-354 aaPF13359DDE_Tnp_4302-346 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA01G132090 | PF04827 | Plant_tran | 260 | 354 | 4.5e-23 | 82.7 |
| TkA01G132090 | PF13359 | DDE_Tnp_4 | 302 | 346 | 0.00017 | 22.0 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.