TkA01G103080 | RubberDandelionOmics

Gene overview

TkA01G103080

Reference: TK1151 Chr: Chr01 Coordinates: 26156865-26166983 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2184 bp · TkA01G103080|TK1151|cDNA

CAAAATTCCGAAATTTTGAATAAGCCGTCGATCTTTCAGCCTTCACTTCACGCTCGCGACCTGAAATCAGACTCTTCCCCTTCGTTTCTTCCGGCGGTGTGCCCTGAAATCAGAATACGCCGACGACCGACGTCGACTTCCGGCGGTGTACTCTTCCTCTTCGACGCTCGCGACTTCGACAGGCTGCGACGACAGGCGCGACTTCGTCAGGCTGTCCAATCTTATAAACCGAACAAAATTAGGGCGCACGTAAGTTTCAA...

CDS

Download CDS FASTA

5904 bp · TkA01G103080|TK1151|CDS

ATGGGTCGTCCGGAACCTTCCGTATTGTTTGCACAAACATTTGCCCATGCACACCTTGATGAATATGTTGATGAGGTTATATTTTCCGAACCTGTTATTGTCAGTGCTTGTGAGTTTCTTGAACAAAGCTCATCATCATCATCTCCAGCAGTAACACTTATGGGGGCCACCTCACCTCCTTCATTTGCTCTAGAGGTCTTTGTTCATTGTGAAGGGGAGACAAGGTTTAGGCGGCTATGCCAGCCTTTTCTCTATTCCCC...

Protein

Download Protein FASTA

1967 aa · TkA01G103080|TK1151|PROTEIN

MGRPEPSVLFAQTFAHAHLDEYVDEVIFSEPVIVSACEFLEQSSSSSSPAVTLMGATSPPSFALEVFVHCEGETRFRRLCQPFLYSPSSSNVLEVEALVTSHLVVRGSYRSLSLVVYGNTGEDLGQFNLEVDLDTSLTNTVSIVEGNLEDLPPALNPLKSTIEEPLSPLKSLTLKTPIASDISLEIKQFLQLSLKILEMPNAGGSLNAVVNSLVSAAVAYSNQSLYRASASQSKSVDLEESCFDFSQARKELLDVYSALL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G103080`
TK1151 ID	TkA01G103080
OH-1004 ID	LXL04_004831
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G103080

Location Chr01:26156865-26166983 (+)

Description Similar to VIR: Protein virilizer homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g05680`	Subunit of the N6-methyltransferase complex, a multiprotein complex that mediates N6-methyladenosine (m6A) methylation at the 5'-[AG]GAC-3' consensus sites of some mRNAs.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004831 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0001510 RNA methylation Biological Process

GO:0006397 mRNA processing Biological Process

GO:0008380 RNA splicing Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0010117 photoprotection Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0016607 nuclear speck Cellular Component

GO:0036396 RNA N6-methyladenosine methyltransferase complex Cellular Component

GO:0008174 mRNA methyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT3G05680

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.522

Rank 1 · TkA01G103080 · TK1151

Cytoplasm0.329

Rank 2 · TkA01G103080 · TK1151

Golgi apparatus0.093

Rank 3 · TkA01G103080 · TK1151

Endoplasmic reticulum0.092

Rank 4 · TkA01G103080 · TK1151

Cell membrane0.090

Rank 5 · TkA01G103080 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24768ARM_ARMC5327-378 aa

PF23195UBQLN1640-657 aa

PF24768ARM_ARMC5941-965 aa

PF24768ARM_ARMC51175-1247 aa

PF23195UBQLN11195-1221 aa

PF23195UBQLN11925-1963 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G103080	`PF24768`	ARM_ARMC5	327	378	0.011	15.8
TkA01G103080	`PF23195`	UBQLN1	640	657	0.28	11.7
TkA01G103080	`PF24768`	ARM_ARMC5	941	965	0.011	15.8
TkA01G103080	`PF24768`	ARM_ARMC5	1175	1247	0.011	15.8
TkA01G103080	`PF23195`	UBQLN1	1195	1221	0.28	11.7
TkA01G103080	`PF23195`	UBQLN1	1925	1963	0.28	11.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4J8G7`	Arabidopsis thaliana	sp\|F4J8G7\|VIR_ARATH Protein virilizer homolog	49.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card