RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G100480
Reference: TK1151 Chr: Chr01 Coordinates: 25407905-25413969 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1356 bp · TkA01G100480|TK1151|cDNA

TGGACTTCCACGTTATCCTTCCATCATCTTCTTGATAGCTCATATTGAATCTTCCAAATTTCGGGTCAGTTACTCAAATTATATGGATAGTGACATCCGAAACTGGATATAGTACCCATACAACAACACTAATAGCAAAAGCTCGCCTTCACGATTCTCGCTCTGGTTGTTTCAACTTTCACCCCCTTACAACACTCTCTCTCATCATTGATTTGGTATCTCAATGCTCAAATGCATGTTTGTCTCTTCTATTCTTTCAT...

CDS

Download CDS FASTA

912 bp · TkA01G100480|TK1151|CDS

ATGAACGACCTCTTATCCAAAGCAAACAGTCCCCAAAGATGCAGTTATGGCGGTGGAGATATTGAAACGGGAAGGCAATCTGGAGAATTAGACTTGGATGAACATTTCAGGAAGGTTCAAGCCATAGAGAAAGAATTTGAGAAGCTTAATAAACTTCTAAGGAAACTACAGGACGCTCATGAAGAATCAAAATCTGTAACCAAGGCTGCTGCAATGAAAGCAATCAAGAAACGAATGGAGAATGATGTTGAAGAAGTTGG...

Protein

Download Protein FASTA

303 aa · TkA01G100480|TK1151|PROTEIN

MNDLLSKANSPQRCSYGGGDIETGRQSGELDLDEHFRKVQAIEKEFEKLNKLLRKLQDAHEESKSVTKAAAMKAIKKRMENDVEEVGSVARFIKAKIQELDRENLANRQKPGCGQGTGVERSRTATTLALKKKFKSKVTGFQALRENIHQEYREVVERRVFTVTGTRADEETIDQLIETGNSEQIYQKAIQQQGRGQVIDTLAEIQERHDAVIEVERKLLELHQIFSDLSILVDAQGEILDNIETQVSSAVEHVQSGNRT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G100480
TK1151 IDTkA01G100480
OH-1004 IDLXL04_004876
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)99.300
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G100480
LocationChr01:25407905-25413969 (+)
DescriptionSimilar to SYP131: Putative syntaxin-131
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g08080 Vesicle trafficking protein that functions in the secretory pathway (Probable).
Syntaxin of plant proteins SYP123 and SYP132 mediate root hair tip growth in Arabidopsis thaliana.2014 · DOI: 10.1093/pcp/pcu048
Concerted Action of Evolutionarily Ancient and Novel SNARE Complexes in Flowering-Plant Cytokinesis.2018 · DOI: 10.1016/j.devcel.2017.12.027
Unusual Roles of Secretory SNARE SYP132 in Plasma Membrane H+-ATPase Traffic and Vegetative Plant Growth.2019 · DOI: 10.1104/pp.19.00266
At3g03800 Vesicle trafficking protein that functions in the secretory pathway. No verified direct reference in this release
At1g11250 Vesicle trafficking protein that functions in the secretory pathway. No verified direct reference in this release
At3g11820 Vesicle trafficking protein that functions in the secretory pathway (By similarity).
Arabidopsis SNAREs SYP61 and SYP121 coordinate the trafficking of plasma membrane aquaporin PIP2;7 to modulate the cell membrane water permeability.2014 · DOI: 10.1105/tpc.114.127159

Rice

Reference gene IDPossible functionPapers / DOI
Os07g0164300 Vesicle trafficking protein that functions in the secretory pathway (By similarity).
The Rice Qa-SNAREs in SYP13 Subfamily Are Involved in Regulating Arbuscular Mycorrhizal Symbiosis and Seed Fertility.2022 · DOI: 10.3389/fpls.2022.898286
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_004876 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006886 intracellular protein transport Biological Process
GO:0006887 exocytosis Biological Process
GO:0006897 endocytosis Biological Process
GO:0006906 vesicle fusion Biological Process
GO:0009860 pollen tube growth Biological Process
GO:0048278 vesicle docking Biological Process
GO:0051301 cell division Biological Process
GO:0061025 membrane fusion Biological Process
GO:0005634 nucleus Cellular Component
GO:0005802 trans-Golgi network Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0009504 cell plate Cellular Component
KEGG gene cross-reference
ath:AT1G11250
ath:AT1G61290
ath:AT5G08080
dosa:Os07g0164300
osa:4342474
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.663
Rank 1 · TkA01G100480 · TK1151
Cytoplasm0.273
Rank 2 · TkA01G100480 · TK1151
Lysosome / Vacuole0.083
Rank 3 · TkA01G100480 · TK1151
Golgi apparatus0.081
Rank 4 · TkA01G100480 · TK1151
Endoplasmic reticulum0.079
Rank 5 · TkA01G100480 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26551DUF818030-56 aa
PF00804Syntaxin31-190 aa
PF05531NPV_P1031-62 aa
PF05192MutS_III33-149 aa
PF05739SNARE34-57 aa
PF05073Baculo_p2434-85 aa
PF07303Occludin_ELL37-84 aa
PF08393DHC_N240-181 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA01G100480PF26551DUF818030560.08414.1
TkA01G100480PF00804Syntaxin311907e-48163.1
TkA01G100480PF05531NPV_P1031621.89.8
TkA01G100480PF05192MutS_III331490.9810.4
TkA01G100480PF05739SNARE34571.1e-2590.0
TkA01G100480PF05073Baculo_p2434851.89.2
TkA01G100480PF07303Occludin_ELL37843.39.2
TkA01G100480PF08393DHC_N2401810.0115.5
TkA01G100480PF18501REC1421550.8410.2
TkA01G100480PF14023Bestrophin-like43710.05813.7
TkA01G100480PF21109Stonustoxin_helical43660.3711.7
TkA01G100480PF20394DUF668844660.899.8
TkA01G100480PF09537DUF2383461030.4911.3
TkA01G100480PF09716ETRAMP47720.05714.1
TkA01G100480PF27707UCP01294347932.78.5
TkA01G100480PF20225DUF658451850.2711.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q8VZU2Arabidopsis thalianasp|Q8VZU2|SY132_ARATH Syntaxin-13269.400%Swiss-ProtHigh
Q9SRV7Arabidopsis thalianasp|Q9SRV7|SY131_ARATH Putative syntaxin-13167.600%Swiss-ProtHigh
Q9SXB0Arabidopsis thalianasp|Q9SXB0|SY125_ARATH Syntaxin-12543.500%Swiss-ProtMedium
Q9ZSD4Arabidopsis thalianasp|Q9ZSD4|SY121_ARATH Syntaxin-12144.500%Swiss-ProtMedium
Q7XIE2Oryza sativa subsp. japonicasp|Q7XIE2|SY132_ORYSJ Syntaxin-13261.700%Swiss-ProtHigh

JBrowse

View in Genome Browser