TkA01G098900 | RubberDandelionOmics

Gene overview

TkA01G098900

Reference: TK1151 Chr: Chr01 Coordinates: 25018512-25023091 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2115 bp · TkA01G098900|TK1151|cDNA

ATCAGATAGATGGCATACCATACGTATTATATAACTAGAGTACTATTCGACTACGACAGTCCACGATCTTGGGCGATTTTGGGGCTTTATCCGTTATTTATTACCAAATCTCTTGAATGAACGTCGTGATTTTGTGGAACTAAATCGAATTTAATATGCGCGGTTGCGTTGGTGAATGTTGGGCTGGATTCGTGGGATGTCTAGTAAGGAGAAAGCAGGTTGATGCAACTGTCGCTAGAGCTGAGGGTTTTCAATTAGCC...

CDS

Download CDS FASTA

1791 bp · TkA01G098900|TK1151|CDS

ATGCGCGGTTGCGTTGGTGAATGTTGGGCTGGATTCGTGGGATGTCTAGTAAGGAGAAAGCAGGTTGATGCAACTGTCGCTAGAGCTGAGGGTTTTCAATTAGCCAAACGTCTCTCTGTTTTTGATCTCATCGCCATCGGAGTCGGGGCAACAATCGGGGCCGGAGTTTACATTCTCGTAGGAACAGTCGCTAAAGAGCAAACAGGGCCCGCAATCACAATCTCATTCCTCATAGCCGGAATCGCATCTGGACTTTCAGC...

Protein

Download Protein FASTA

596 aa · TkA01G098900|TK1151|PROTEIN

MRGCVGECWAGFVGCLVRRKQVDATVARAEGFQLAKRLSVFDLIAIGVGATIGAGVYILVGTVAKEQTGPAITISFLIAGIASGLSAFCYAELACRCPSAGSAYHYSYLCVGEGVAWLIGWSLILEYTLGGAAVARGISPNMAVFFGGPDMLPAFLSRPTILGIVVDPCAAVLVFIITGLLCTGIKESSLAQGIITTINVVALLFIIIVGGYVGFKTQWVGYQVQGGYFPFGANGVLAGSATVFFSYVGFDAVTSTAEEV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G098900`
TK1151 ID	TkA01G098900
OH-1004 ID	LXL04_004890
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G098900

Location Chr01:25018512-25023091 (-)

Description Similar to CAT2: Cationic amino acid transporter 2, vacuolar

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g58030`	Permease involved in the transport of the cationic amino acids.	No verified direct reference in this release
`At3g03720`	Permease involved in the transport of the cationic amino acids.	No verified direct reference in this release
`At5g36940`	Permease involved in the transport of the cationic neutral or acidic amino acids.	Molecular and functional characterization of a family of amino acid transporters from Arabidopsis.2004 · DOI: 10.1104/pp.104.045278

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004890 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006865 amino acid transport Biological Process

GO:0015807 L-amino acid transport Biological Process

GO:0015819 lysine transport Biological Process

GO:0015822 ornithine transport Biological Process

GO:0032006 regulation of TOR signaling Biological Process

GO:0080144 intracellular amino acid homeostasis Biological Process

GO:0089718 amino acid import across plasma membrane Biological Process

GO:0097638 L-arginine import across plasma membrane Biological Process

GO:0098655 monoatomic cation transmembrane transport Biological Process

GO:1903352 L-ornithine transmembrane transport Biological Process

GO:1903401 L-lysine transmembrane transport Biological Process

GO:1903810 L-histidine import across plasma membrane Biological Process

KEGG gene cross-reference

ath:AT1G58030

ath:AT3G03720

ath:AT5G36940

hsa:6541

mmu:11987

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.356

Rank 1 · TkA01G098900 · TK1151

Cell membrane0.322

Rank 2 · TkA01G098900 · TK1151

Endoplasmic reticulum0.154

Rank 3 · TkA01G098900 · TK1151

Cytoplasm0.134

Rank 4 · TkA01G098900 · TK1151

Golgi apparatus0.110

Rank 5 · TkA01G098900 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13906AA_permease_C37-63 aa

PF13520AA_permease_238-420 aa

PF00324AA_permease43-411 aa

PF13906AA_permease_C522-572 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G098900	`PF13906`	AA_permease_C	37	63	1.2e-23	83.6
TkA01G098900	`PF13520`	AA_permease_2	38	420	7.2e-51	174.1
TkA01G098900	`PF00324`	AA_permease	43	411	8.6e-39	134.2
TkA01G098900	`PF13906`	AA_permease_C	522	572	1.2e-23	83.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ASS7`	Arabidopsis thaliana	sp\|Q9ASS7\|CAAT2_ARATH Cationic amino acid transporter 2, vacuolar	62.200%	Swiss-Prot	High
`Q8W4K3`	Arabidopsis thaliana	sp\|Q8W4K3\|CAAT4_ARATH Cationic amino acid transporter 4, vacuolar	62.700%	Swiss-Prot	High
`Q8GYB4`	Arabidopsis thaliana	sp\|Q8GYB4\|CAAT3_ARATH Cationic amino acid transporter 3, mitochondrial	59.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card