Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1244 bp · TkA01G092600|TK1151|cDNA
CAAAACCCATGAATAATCTCTACGATACAATCTCTCTTCTCTTGATTCTATCATCGTTCTCCTTCACTTATGGGTTCGGATCCATGGGTCCTATATCGGCTGTGTTTGGCCAAAATGACTTCTTTTGTGCCATTGATGCAAGTGGGAAGCAAGAAGTTATTTGCTGGGGGAAGAACACGAGTTCGTCTTCTTCGACTTCCTCGGTGTTCGCTATTGATGTCCCGCCCATGGCAGCTTTGAGTGGAGGTTACGGGTTTATG...
723 bp · TkA01G092600|TK1151|CDS
ATGCATCTTGTTGGGACTCTACGGGTTCCACTTCTGATCTTGTTCCTCAGCGATTCCGGTTCGGTTGATTGCTGGGACATCGTTGAAACGTCAGGAAATCGGTTCAGTTCAAAACAGAGTGCTCTGTACTACAATCAAGAAATCAGCTCGCTTTCCTTCAAAAAGATTGTGTCTGGTGAAGGGTTTAGCTGCGGCGCTCTTAAAGATGGTGGGATTAAATGTTGGGGCCCAACGGCCTCGAATTTAGGCGTTCCTAATCT...
Protein
Download Protein FASTA240 aa · TkA01G092600|TK1151|PROTEIN
MHLVGTLRVPLLILFLSDSGSVDCWDIVETSGNRFSSKQSALYYNQEISSLSFKKIVSGEGFSCGALKDGGIKCWGPTASNLGVPNLPEKLLALASGKSSVCGVLESSGEIKCWGDGDSSFSNSSILDPPIGASFVALAIGSQHFCGIRNDNHAIECWGKVNSSSIPKDSGFLSIASSDSITCGIREDDLVLDCWFANTSSPSDDIDPPLQLCSPGLCTPGSLAEKGNSLSTRVFFTNQI
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA01G092600 |
|---|---|
| TK1151 ID | TkA01G092600 |
| OH-1004 ID | LXL04_004973 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 83.750 / OH-1004 26.447Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA01G092600 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr01:23407425-23408751 (+) | |||||||||
| Description | Similar to CCR1: Serine/threonine-protein kinase-like protein CCR1 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0009786 regulation of asymmetric cell division Biological Process GO:0009793 embryo development ending in seed dormancy Biological Process GO:0010311 lateral root formation Biological Process GO:0032877 positive regulation of DNA endoreduplication Biological Process GO:0046777 protein autophosphorylation Biological Process GO:0048364 root development Biological Process GO:0048439 flower morphogenesis Biological Process GO:0048829 root cap development Biological Process GO:0090392 sepal giant cell differentiation Biological Process GO:0090627 plant epidermal cell differentiation Biological Process GO:0099402 plant organ development Biological Process GO:0005886 plasma membrane Cellular Component | |||||||||
| KEGG gene cross-reference | ath:AT2G39180 ath:AT3G09780 ath:AT3G59420 dosa:Os03g0637800 zma:542346 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF13540RCC1_214-25 aaPF25390WD40_RLD47-115 aaPF13540RCC1_253-76 aaPF25390WD40_RLD86-160 aaPF13540RCC1_294-118 aaPF13540RCC1_2136-160 aaPF13540RCC1_2174-191 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA01G092600 | PF13540 | RCC1_2 | 14 | 25 | 9.2e-13 | 48.3 |
| TkA01G092600 | PF25390 | WD40_RLD | 47 | 115 | 0.00091 | 19.4 |
| TkA01G092600 | PF13540 | RCC1_2 | 53 | 76 | 9.2e-13 | 48.3 |
| TkA01G092600 | PF25390 | WD40_RLD | 86 | 160 | 0.00091 | 19.4 |
| TkA01G092600 | PF13540 | RCC1_2 | 94 | 118 | 9.2e-13 | 48.3 |
| TkA01G092600 | PF13540 | RCC1_2 | 136 | 160 | 9.2e-13 | 48.3 |
| TkA01G092600 | PF13540 | RCC1_2 | 174 | 191 | 9.2e-13 | 48.3 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.