Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1842 bp · TkA01G085510|TK1151|cDNA
CAACCGAAGAAAGATAATGAGAAACTGTCGAAAAAACTTTCAAGAGTGTTCTCGGAAGACTACGCAAAAACCAAAAACACAATTCTTGATCCTCGAGGCTCGACTTTGAATCAATGGAACCAAGTCTTTCTAATTGCGGCTCTTGTTTCACTTGCTGTAGACCCTCTCTTCTTTTACTTGCCTATAATCAAGGACGACATGTGTTTAGACGAAGATACTACACTCAAGATAACCCTCACTGTCATTCGTACAATCGTGGA...
1842 bp · TkA01G085510|TK1151|CDS
CAACCGAAGAAAGATAATGAGAAACTGTCGAAAAAACTTTCAAGAGTGTTCTCGGAAGACTACGCAAAAACCAAAAACACAATTCTTGATCCTCGAGGCTCGACTTTGAATCAATGGAACCAAGTCTTTCTAATTGCGGCTCTTGTTTCACTTGCTGTAGACCCTCTCTTCTTTTACTTGCCTATAATCAAGGACGACATGTGTTTAGACGAAGATACTACACTCAAGATAACCCTCACTGTCATTCGTACAATCGTGGA...
Protein
Download Protein FASTA613 aa · TkA01G085510|TK1151|PROTEIN
QPKKDNEKLSKKLSRVFSEDYAKTKNTILDPRGSTLNQWNQVFLIAALVSLAVDPLFFYLPIIKDDMCLDEDTTLKITLTVIRTIVDIFYAIKIYVRFRTAYVAPSSRLLGRGELILDTSSISQKYLSGEFWLDLLATLPIPQVMTWFQIVDKTELISTKTSVLYFIMLQFILRLCLTFRLGSHISKQAGLVANVAWVGAAYNLVLFMLAAHVIGAMWYLLAIERQGLCWVEICDVEIECHHRYFDCRNVNVPAREAWFP...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA01G085510 |
|---|---|
| TK1151 ID | TkA01G085510 |
| OH-1004 ID | LXL04_012688 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 59.300 |
| Protein coverage (%) | TK1151 99.184 / OH-1004 97.277Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA01G085510 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr01:21813955-21816738 (+) | |||||||||
| Description | Similar to CNGC15C: Protein CNGC15c | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0009617 response to bacterium Biological Process GO:0009877 nodulation Biological Process GO:0036377 arbuscular mycorrhizal association Biological Process GO:0051592 response to calcium ion Biological Process GO:0070588 calcium ion transmembrane transport Biological Process GO:0071249 cellular response to nitrate Biological Process GO:0005634 nucleus Cellular Component GO:0005886 plasma membrane Cellular Component GO:0031965 nuclear membrane Cellular Component GO:0005249 voltage-gated potassium channel activity Molecular Function GO:0005262 calcium channel activity Molecular Function GO:0005516 calmodulin binding Molecular Function | |||||||||
| KEGG gene cross-reference | ath:AT2G24610 ath:AT2G28260 mtr:11433273 mtr:25487817 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00520Ion_trans39-354 aaPF14377UBM394-413 aaPF00027cNMP_binding449-502 aaPF00612IQ535-552 aaPF14377UBM604-609 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA01G085510 | PF00520 | Ion_trans | 39 | 354 | 1.2e-19 | 71.1 |
| TkA01G085510 | PF14377 | UBM | 394 | 413 | 0.34 | 11.1 |
| TkA01G085510 | PF00027 | cNMP_binding | 449 | 502 | 9.6e-06 | 26.2 |
| TkA01G085510 | PF00612 | IQ | 535 | 552 | 0.1 | 13.2 |
| TkA01G085510 | PF14377 | UBM | 604 | 609 | 0.34 | 11.1 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.