TkA01G071770 | RubberDandelionOmics

Gene overview

TkA01G071770

Reference: TK1151 Chr: Chr01 Coordinates: 18423017-18426534 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1311 bp · TkA01G071770|TK1151|cDNA

ATGGCTGCATTCGATTCAACATTGTTTTCTAGTTTATACGAGCCTCTCTCGGGCCTCAACGAGATGGATTTCGAGTTGCATGGTATCTATATGGATCACGAACCAGAGAAGGAATTTGTTACCCCATTGAAAAAATGTAAGGATACATTACTAAATATTCTTCTTAGTGATGAGAATCTACGAAAATCAAGCATAGTTGATGAGGTTAGGGCACAAGTTTATCACGTTGCTGATTGGAACAATGATGAAGAGGTGGGGGA...

CDS

Download CDS FASTA

1311 bp · TkA01G071770|TK1151|CDS

ATGGCTGCATTCGATTCAACATTGTTTTCTAGTTTATACGAGCCTCTCTCGGGCCTCAACGAGATGGATTTCGAGTTGCATGGTATCTATATGGATCACGAACCAGAGAAGGAATTTGTTACCCCATTGAAAAAATGTAAGGATACATTACTAAATATTCTTCTTAGTGATGAGAATCTACGAAAATCAAGCATAGTTGATGAGGTTAGGGCACAAGTTTATCACGTTGCTGATTGGAACAATGATGAAGAGGTGGGGGA...

Protein

Download Protein FASTA

436 aa · TkA01G071770|TK1151|PROTEIN

MAAFDSTLFSSLYEPLSGLNEMDFELHGIYMDHEPEKEFVTPLKKCKDTLLNILLSDENLRKSSIVDEVRAQVYHVADWNNDEEVGDLLSRIWGNKKHFLPTSTAPSFHAPRPGDDLHSPVHILHSDFRVDAGVIDFRFRHKDSEHLLLRFHTGYSEFKDKATTGKQGLGIKDRPRKVAEQGVSNKELNYICLVHSSNQFTGRLFEVDLGLFDGSQLETVAAEEPNADKAPCNNDATTKTCSEDYIALLIEHDNEESDDG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G071770`
TK1151 ID	TkA01G071770
OH-1004 ID	LXL04_005259
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G071770`
Location	Chr01:18423017-18426534 (-)
Description	Similar to A1CF: APOBEC1 complementation factor
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_005259` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006397 mRNA processing Biological Process GO:0007283 spermatogenesis Biological Process GO:0008380 RNA splicing Biological Process GO:0016554 cytidine to uridine editing Biological Process GO:0016556 mRNA modification Biological Process GO:0050821 protein stabilization Biological Process GO:0051321 meiotic cell cycle Biological Process GO:0140374 antiviral innate immune response Biological Process GO:0141166 chromosomal 5-methylcytosine DNA demethylation pathway Biological Process GO:1902373 negative regulation of mRNA catabolic process Biological Process GO:1905146 lysosomal protein catabolic process Biological Process GO:2000623 negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay Biological Process
KEGG gene cross-reference	dre:562991 hsa:29974 pon:100174508 xtr:779956 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.729

Rank 1 · TkA01G071770 · TK1151

Cytoplasm0.257

Rank 2 · TkA01G071770 · TK1151

Cell membrane0.045

Rank 3 · TkA01G071770 · TK1151

Mitochondrion0.040

Rank 4 · TkA01G071770 · TK1151

Endoplasmic reticulum0.033

Rank 5 · TkA01G071770 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00076RRM_1279-350 aa

PF16367RRM_7279-332 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G071770	`PF00076`	RRM_1	279	350	9.5e-08	32.5
TkA01G071770	`PF16367`	RRM_7	279	332	0.13	13.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card