TkA01G069000 | RubberDandelionOmics

Gene overview

TkA01G069000

Reference: TK1151 Chr: Chr01 Coordinates: 17663201-17664433 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1203 bp · TkA01G069000|TK1151|cDNA

ATGAATCCATTTAAACACGTACGTAGCCAATTTCATCTCACAACTCCTCTCAGAACCAATAATCTAACCGCGTTCATACATCTAAATCCGATCTCTTATCACTCCTCCTCTGAATCACATCTAAATCCCCAATCTTCCGAGTGGCGTGAAAGAGCCCTCCCGAAACTAATCAAACTAACCCCATTGCTAAACAATCTAGACCTAATCAACGGAAAATTGATCAACATCCACGACAAATCCACCGTGAACGACGAATTCCT...

CDS

Download CDS FASTA

1203 bp · TkA01G069000|TK1151|CDS

ATGAATCCATTTAAACACGTACGTAGCCAATTTCATCTCACAACTCCTCTCAGAACCAATAATCTAACCGCGTTCATACATCTAAATCCGATCTCTTATCACTCCTCCTCTGAATCACATCTAAATCCCCAATCTTCCGAGTGGCGTGAAAGAGCCCTCCCGAAACTAATCAAACTAACCCCATTGCTAAACAATCTAGACCTAATCAACGGAAAATTGATCAACATCCACGACAAATCCACCGTGAACGACGAATTCCT...

Protein

Download Protein FASTA

400 aa · TkA01G069000|TK1151|PROTEIN

MNPFKHVRSQFHLTTPLRTNNLTAFIHLNPISYHSSSESHLNPQSSEWRERALPKLIKLTPLLNNLDLINGKLINIHDKSTVNDEFLLQSMHNFKSIATSFLAYHSIIQSSSTSAYMEPLTLNSLKKVCDILDVSAQQRKLVRLAICPQITHHQIWTRALEEILNQLKIKLGINDHESIMTHQIVVKCLMFLDDVMSYDPNSTSWMRLAPTKKDSDFPRSAKWEDFLEMLNDLIICLKNEEDLSFYVTKLESMKEGLLQI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G069000`
TK1151 ID	TkA01G069000
OH-1004 ID	LXL04_005295
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	92.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G069000`
Location	Chr01:17663201-17664433 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_005295` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.518

Rank 1 · TkA01G069000 · TK1151

Nucleus0.196

Rank 2 · TkA01G069000 · TK1151

Cytoplasm0.137

Rank 3 · TkA01G069000 · TK1151

Plastid0.095

Rank 4 · TkA01G069000 · TK1151

Cell membrane0.031

Rank 5 · TkA01G069000 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF20266Mab-21_C27-57 aa

PF01540Lipoprotein_762-102 aa

PF20266Mab-21_C89-141 aa

PF20266Mab-21_C145-168 aa

PF17611DUF5506152-207 aa

PF01540Lipoprotein_7154-175 aa

PF20266Mab-21_C219-251 aa

PF01540Lipoprotein_7244-255 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G069000	`PF20266`	Mab-21_C	27	57	0.32	11.9
TkA01G069000	`PF01540`	Lipoprotein_7	62	102	0.55	11.4
TkA01G069000	`PF20266`	Mab-21_C	89	141	0.32	11.9
TkA01G069000	`PF20266`	Mab-21_C	145	168	0.32	11.9
TkA01G069000	`PF17611`	DUF5506	152	207	0.096	13.3
TkA01G069000	`PF01540`	Lipoprotein_7	154	175	0.55	11.4
TkA01G069000	`PF20266`	Mab-21_C	219	251	0.32	11.9
TkA01G069000	`PF01540`	Lipoprotein_7	244	255	0.55	11.4
TkA01G069000	`PF17611`	DUF5506	330	353	0.096	13.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card