TkA01G066020 | RubberDandelionOmics

Gene overview

TkA01G066020

Reference: TK1151 Chr: Chr01 Coordinates: 16870978-16873519 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2443 bp · TkA01G066020|TK1151|cDNA

GTGGGTCCTTCACAGCTCCAACTTTAGATGCGAATTGTCGTTTCAATCAAGCATCATCGCTGGCAGTTTCCTCCATCGATTAATAATCAATTCCTCTTTCTCAAAAACTTTCCGCCAAAAATTCCTTTGTTTCTTCGTCTCCTCAATCGAATTATTCCTCCCCCAAACCCGCCTCTTCTTATTTCCAAATCGATTTGGGTTTCCAGACATATAACAATCGATAGAGAAACACATTCGTATTGATTTGTTATTTCCATTTT...

CDS

Download CDS FASTA

1653 bp · TkA01G066020|TK1151|CDS

ATGGGGAAACCTACCGGTAAGAAGAAATTACAGGGTGGAGCTGAAAAAGGAACGAAGCAGAACAAAGCAGCTGGATCTGATCGAACTTCGACACAAGTTATTGAATCAAATCCATCAAAGACAGTCAATGTCCTGAAAGAGAACAGGAGCAATGGTTTTGAGACTAAAAAGGGCGAAGAAGTCAACAAGAGCAAAAATATGGAGAAATCAAACAGAGGTAAACAAAAGAGAGGCGATAAGAAGACGATTAAGGAGGATAC...

Protein

Download Protein FASTA

550 aa · TkA01G066020|TK1151|PROTEIN

MGKPTGKKKLQGGAEKGTKQNKAAGSDRTSTQVIESNPSKTVNVLKENRSNGFETKKGEEVNKSKNMEKSNRGKQKRGDKKTIKEDTKIVKEEQVAMKTVKLVLGDDIRWAQLPVNCSIGLVRQIVRDRFPSLHGVLIKYKDREGDLITIVTTTELRFAETSCDPQGTFKLYLVEVTPDKEPSYEGYENEQIPNASENTITGKKGKSEEGITNSIEEWIVQFSRLFKNHVGFDTDPYLDLHELGMELYSEAMEDTVPTES...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G066020`
TK1151 ID	TkA01G066020
OH-1004 ID	LXL04_015480
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	66.700
Protein coverage (%)	TK1151 79.636 / OH-1004 54.167 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G066020

Location Chr01:16870978-16873519 (+)

Description Similar to PHOX1: Protein PHOX1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g25290`	Carboxylate clamp type tetratricopeptide repeat protein that may act as a potential Hsp90/Hsp70 co-chaperone.	Myosin-driven transport network in plants.2017 · DOI: 10.1073/pnas.1620577114
`At4g32070`	Carboxylate clamp-type tetratricopeptide repeat protein that may act as a potential Hsp90/Hsp70 co-chaperone.	No verified direct reference in this release
`At1g62390`	Required for plastid separation and partitioning during cell division.	CLUMPED CHLOROPLASTS 1 is required for plastid separation in Arabidopsis.2011 · DOI: 10.1073/pnas.1106706108
`At5g20360`	Carboxylate clamp type tetratricopeptide repeat protein that may act as a potential Hsp90/Hsp70 co-chaperone.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015480 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0010494 cytoplasmic stress granule Cellular Component

GO:0030659 cytoplasmic vesicle membrane Cellular Component

GO:0003729 mRNA binding Molecular Function

GO:0080115 myosin XI tail binding Molecular Function

KEGG gene cross-reference

ath:AT1G62390

ath:AT2G25290

ath:AT4G32070

ath:AT5G20360

zma:103641203

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.605

Rank 1 · TkA01G066020 · TK1151

Nucleus0.341

Rank 2 · TkA01G066020 · TK1151

Cell membrane0.119

Rank 3 · TkA01G066020 · TK1151

Golgi apparatus0.065

Rank 4 · TkA01G066020 · TK1151

Endoplasmic reticulum0.061

Rank 5 · TkA01G066020 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00564PB199-175 aa

PF13414TPR_11271-289 aa

PF07719TPR_2277-290 aa

PF00515TPR_1277-289 aa

PF13414TPR_11316-347 aa

PF07719TPR_2316-337 aa

PF00515TPR_1316-338 aa

PF07719TPR_2338-354 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G066020	`PF00564`	PB1	99	175	1.3e-11	45.0
TkA01G066020	`PF13414`	TPR_11	271	289	2.2e-06	28.0
TkA01G066020	`PF07719`	TPR_2	277	290	0.055	14.3
TkA01G066020	`PF00515`	TPR_1	277	289	0.78	10.4
TkA01G066020	`PF13414`	TPR_11	316	347	2.2e-06	28.0
TkA01G066020	`PF07719`	TPR_2	316	337	0.055	14.3
TkA01G066020	`PF00515`	TPR_1	316	338	0.78	10.4
TkA01G066020	`PF07719`	TPR_2	338	354	0.055	14.3
TkA01G066020	`PF00515`	TPR_1	341	353	0.78	10.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4IRM4`	Arabidopsis thaliana	sp\|F4IRM4\|PHOX1_ARATH Protein PHOX1	57.600%	Swiss-Prot	High
`F4JTI1`	Arabidopsis thaliana	sp\|F4JTI1\|PHOX4_ARATH Protein PHOX4	57.900%	Swiss-Prot	High
`O48802`	Arabidopsis thaliana	sp\|O48802\|PHOX2_ARATH Protein CLMP1	41.400%	Swiss-Prot	Medium
`F4K487`	Arabidopsis thaliana	sp\|F4K487\|PHOX3_ARATH Protein PHOX3	39.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card