TkA01G063870 | RubberDandelionOmics

Gene overview

TkA01G063870

Reference: TK1151 Chr: Chr01 Coordinates: 16438242-16441185 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1811 bp · TkA01G063870|TK1151|cDNA

GGGGAAAGGAGTTTGCTCATCGCCCTTTTCTTCTTTCTACCTTCTTTTCCCTTTTTCAAGTATCTTCCGTCCTTTCTCAAGTATCTAATTCCATCCAACAAAGCAGTCCGTCTCCTCGTCACTAACAACTCCTTCTGCACATCCATGGCTGCTTCTCTGTAATCCTCATTTCCCACCACCCTCTCTCACGTTACCCACTAATCAGTCTCCTTTTTGTTTTTTCAATAGTACAGCTTTCAAGAACTGTAAATGAAAATTTT...

CDS

Download CDS FASTA

1323 bp · TkA01G063870|TK1151|CDS

ATGAAAATTTTGGTGTGTTTTCTGTTCAATTTGATTTTGAATCTTCAAATTACCACCATTGACGCCAGACCCAGCAAGTTAATACTCCTTTCTGATATCCCTATTCATGAATTATCACCTGCGTCTGCTCCCATATCTTCAATGGCGGATTTCCCTCCCGGAGCTCATATGGATATCCCAACCCACCAAAATTCAAACAAGAAGCTTGTTATAGGACTCGTTGCTGGGTCTTGTCTCATAGGAGTCATCTTATTGCCGTT...

Protein

Download Protein FASTA

440 aa · TkA01G063870|TK1151|PROTEIN

MKILVCFLFNLILNLQITTIDARPSKLILLSDIPIHELSPASAPISSMADFPPGAHMDIPTHQNSNKKLVIGLVAGSCLIGVILLPLTCLWICRRKKLYKSTKINTRRLDSLKGLPLSSFIGRTNTTFNGDKTSVTVMDYKLLQSATNNFHESEIIGQGGFGCVYKAQLNDNLLVAVKKLDNKSQNSVKEFQTEVDILSRIQHPNIITLSGYCIHEETKLLVYELMQNGSLESQLHGPSCGSNLTWHCRMKIALDIARGL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G063870`
TK1151 ID	TkA01G063870
OH-1004 ID	LXL04_005340
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G063870

Location Chr01:16438242-16441185 (-)

Description Similar to At1g80640: Probable receptor-like protein kinase At1g80640

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g80640`	Probable receptor-like protein kinase At1g80640.	No verified direct reference in this release
`At2g20300`	Required during the differentiation of the protoderm into shoots epidermis and cuticle.	Novel receptor-like kinase ALE2 controls shoot development by specifying epidermis in Arabidopsis.2007 · DOI: 10.1242/dev.003533
`At2g28590`	May be involved in plant defense signaling.	No verified direct reference in this release
`At1g07870`	May be involved in plant defense signaling.	No verified direct reference in this release
`At3g20530`	May be involved in plant defense signaling.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005340 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006468 protein phosphorylation Biological Process

GO:0006952 defense response Biological Process

GO:0007165 signal transduction Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0010068 protoderm histogenesis Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0030154 cell differentiation Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0090558 plant epidermis development Biological Process

GO:1900459 positive regulation of brassinosteroid mediated signaling pathway Biological Process

GO:1905393 plant organ formation Biological Process

KEGG gene cross-reference

ath:AT1G07870

ath:AT1G80640

ath:AT2G20300

ath:AT3G20530

ath:AT5G02800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.799

Rank 1 · TkA01G063870 · TK1151

Endoplasmic reticulum0.111

Rank 2 · TkA01G063870 · TK1151

Cytoplasm0.091

Rank 3 · TkA01G063870 · TK1151

Nucleus0.058

Rank 4 · TkA01G063870 · TK1151

Lysosome / Vacuole0.041

Rank 5 · TkA01G063870 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03109ABC1146-188 aa

PF17667Pkinase_fungal148-216 aa

PF00069Pkinase150-368 aa

PF07714PK_Tyr_Ser-Thr153-383 aa

PF14531Kinase-like243-306 aa

PF17667Pkinase_fungal259-324 aa

PF03109ABC1262-298 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G063870	`PF03109`	ABC1	146	188	0.00072	19.5
TkA01G063870	`PF17667`	Pkinase_fungal	148	216	0.2	11.1
TkA01G063870	`PF00069`	Pkinase	150	368	1.2e-49	169.8
TkA01G063870	`PF07714`	PK_Tyr_Ser-Thr	153	383	7.2e-49	167.1
TkA01G063870	`PF14531`	Kinase-like	243	306	0.26	11.2
TkA01G063870	`PF17667`	Pkinase_fungal	259	324	0.2	11.1
TkA01G063870	`PF03109`	ABC1	262	298	0.00072	19.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0V7T5`	Arabidopsis thaliana	sp\|Q0V7T5\|Y1864_ARATH Probable receptor-like protein kinase At1g80640	52.900%	Swiss-Prot	High
`Q8RWW0`	Arabidopsis thaliana	sp\|Q8RWW0\|ALE2_ARATH Receptor-like serine/threonine-protein kinase ALE2	46.200%	Swiss-Prot	Medium
`Q9SIB6`	Arabidopsis thaliana	sp\|Q9SIB6\|PBL6_ARATH Probable serine/threonine-protein kinase PBL6	45.300%	Swiss-Prot	Medium
`Q9LQQ8`	Arabidopsis thaliana	sp\|Q9LQQ8\|PBL5_ARATH Probable serine/threonine-protein kinase PBL5	43.500%	Swiss-Prot	Medium
`F4JEQ2`	Arabidopsis thaliana	sp\|F4JEQ2\|PBL23_ARATH Probable serine/threonine-protein kinase PBL23	44.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card