TkA01G054900 | RubberDandelionOmics

Gene overview

TkA01G054900

Reference: TK1151 Chr: Chr01 Coordinates: 14213400-14217810 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3881 bp · TkA01G054900|TK1151|cDNA

TGTACATAAATCAAGATTCATCCGTTTCGCCTCACGAAAAAGGGTTAGCCATTGACAGCAACAAAAATCCACCACAAACCATCACTATATTTAGTAAAGTTCACCATACACACGCCATATACTTCAATCCTCCGCCATGGTTTTGCTTTCAAGTTGTTAACCCCAAAAATTTGGATATTTTTCCTCAATTAATTCATAAAAATGGCTTCCGGGAGTAGAACAAGCTCAAGGCTTCATCTCCATAGTAACAACCAAGCGTC...

CDS

Download CDS FASTA

3339 bp · TkA01G054900|TK1151|CDS

ATGGCTTCCGGGAGTAGAACAAGCTCAAGGCTTCATCTCCATAGTAACAACCAAGCGTCGTCTTCAGTGAGCAAAGCCACTGCACAATACACAGTCGATGCAAGATTACACGCTGTTTTCGAACAATCCGGCGGCTCCGGTAAGTCCTTCGATTACTCGCAATCACTTAAGACCACCACACAATCATCAAACCCTGAACAGCAAATCAGTGCGTATTTGTCGAGAATTCAAAGAGGTGGTCACATTCAACCCTTCGGTTG...

Protein

Download Protein FASTA

1112 aa · TkA01G054900|TK1151|PROTEIN

MASGSRTSSRLHLHSNNQASSSVSKATAQYTVDARLHAVFEQSGGSGKSFDYSQSLKTTTQSSNPEQQISAYLSRIQRGGHIQPFGCMIAIDDSTFKVIAFSENARERLGLAPQSVPSIEKPEILTIGTDVKTLFTPSSSPLLDRAFRAREITLLNPVWVQSKVSGKPFYAIMHRIDVGIVIDLEPARAEDPALSIAGAVQSQKLAVRAISNLQALPGGDIKLLCDAVVRNVRELTGYDRVMVYKFHEDEHGEVVAESKR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G054900`
TK1151 ID	TkA01G054900
OH-1004 ID	LXL04_005408
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G054900`
Location	Chr01:14213400-14217810 (-)
Description	Similar to PHYB: Phytochrome B
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_005408` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006351 DNA-templated transcription Biological Process GO:0006355 regulation of DNA-templated transcription Biological Process GO:0009584 detection of visible light Biological Process GO:0009585 red, far-red light phototransduction Biological Process GO:0017007 protein-bilin linkage Biological Process GO:0017009 protein-phycocyanobilin linkage Biological Process GO:0017012 protein-phytochromobilin linkage Biological Process GO:0005634 nucleus Cellular Component GO:0000155 phosphorelay sensor kinase activity Molecular Function GO:0009881 photoreceptor activity Molecular Function GO:0042803 protein homodimerization activity Molecular Function
KEGG gene cross-reference	gmx:100794865 sbi:8081072 sly:101262847 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.460

Rank 1 · TkA01G054900 · TK1151

Nucleus0.252

Rank 2 · TkA01G054900 · TK1151

Cell membrane0.172

Rank 3 · TkA01G054900 · TK1151

Golgi apparatus0.098

Rank 4 · TkA01G054900 · TK1151

Endoplasmic reticulum0.097

Rank 5 · TkA01G054900 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08446PAS_271-187 aa

PF13426PAS_987-140 aa

PF13188PAS_888-112 aa

PF01590GAF221-398 aa

PF13426PAS_9285-300 aa

PF00512HisKA381-421 aa

PF00360PHY411-584 aa

PF08447PAS_3449-486 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G054900	`PF08446`	PAS_2	71	187	6.7e-36	124.0
TkA01G054900	`PF13426`	PAS_9	87	140	2e-10	41.6
TkA01G054900	`PF13188`	PAS_8	88	112	1.1e-05	25.8
TkA01G054900	`PF01590`	GAF	221	398	3.8e-17	63.8
TkA01G054900	`PF13426`	PAS_9	285	300	2e-10	41.6
TkA01G054900	`PF00512`	HisKA	381	421	4.6e-11	43.3
TkA01G054900	`PF00360`	PHY	411	584	1.3e-54	185.0
TkA01G054900	`PF08447`	PAS_3	449	486	4.2e-07	30.9
TkA01G054900	`PF00989`	PAS	616	731	7e-46	155.6
TkA01G054900	`PF13188`	PAS_8	619	661	1.1e-05	25.8
TkA01G054900	`PF08448`	PAS_4	624	734	3.2e-11	44.2
TkA01G054900	`PF13426`	PAS_9	628	732	2e-10	41.6
TkA01G054900	`PF08447`	PAS_3	640	695	4.2e-07	30.9
TkA01G054900	`PF02518`	HATPase_c	673	699	2.7e-16	60.7
TkA01G054900	`PF00989`	PAS	747	866	7e-46	155.6
TkA01G054900	`PF08448`	PAS_4	761	865	3.2e-11	44.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card