TkA01G050880 | RubberDandelionOmics

Gene overview

TkA01G050880

Reference: TK1151 Chr: Chr01 Coordinates: 13187412-13189361 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

798 bp · TkA01G050880|TK1151|cDNA

ATGTTAGCTTTTCAGGACTACGGTGGCGCGTCTCTCTTCGATTTGCTTCAACAGCCCACTCCGCCGAACTTAGCTTCCACCGTGACAGAGACGCCTGAGATGGTGAACACGCCGACGCAAAACTCGTCCTCCATCTCATCGTCGTCAAACGAGGCTGCAAATAATGTTGATCAGGAGAATAATAGAAGATCAGCTCAAGAGGATGATGAAGAACAACATGGCAGGTTATTAAAACCGAAAAAGAAGAACCCAAAAAAGCA...

CDS

Download CDS FASTA

798 bp · TkA01G050880|TK1151|CDS

ATGTTAGCTTTTCAGGACTACGGTGGCGCGTCTCTCTTCGATTTGCTTCAACAGCCCACTCCGCCGAACTTAGCTTCCACCGTGACAGAGACGCCTGAGATGGTGAACACGCCGACGCAAAACTCGTCCTCCATCTCATCGTCGTCAAACGAGGCTGCAAATAATGTTGATCAGGAGAATAATAGAAGATCAGCTCAAGAGGATGATGAAGAACAACATGGCAGGTTATTAAAACCGAAAAAGAAGAACCCAAAAAAGCA...

Protein

Download Protein FASTA

265 aa · TkA01G050880|TK1151|PROTEIN

MLAFQDYGGASLFDLLQQPTPPNLASTVTETPEMVNTPTQNSSSISSSSNEAANNVDQENNRRSAQEDDEEQHGRLLKPKKKNPKKQREPRFAFMTKSDVDHLDDGYRWRKYGQKAVKNSPFPRSYHRCTSGMWSEKARERSSDDPTIVITTYEGTHTHPYPMTPRGSIGILPETANYGGLGGGGGGGGVLFAQPHYQHQLQPYFHNNQASPSSSLSFTTSTNSHFLQERRFCPSPSSSLLRDHGLLQDVVPFQIRKEEP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G050880`
TK1151 ID	TkA01G050880
OH-1004 ID	LXL04_005426
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	78.100
Protein coverage (%)	TK1151 100.000 / OH-1004 87.432 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G050880

Location Chr01:13187412-13189361 (-)

Description Similar to WRKY48: Probable WRKY transcription factor 48

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g49520`	Transcription factor.	No verified direct reference in this release
`At1g69310`	Transcription factor.	No verified direct reference in this release
`At1g29860`	Transcription factor.	No verified direct reference in this release
`At4g18170`	Transcription factor.	No verified direct reference in this release
`At2g47260`	Transcription factor.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005426 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009617 response to bacterium Biological Process

GO:0009624 response to nematode Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009723 response to ethylene Biological Process

GO:0009733 response to auxin Biological Process

GO:0010228 vegetative to reproductive phase transition of meristem Biological Process

GO:0042659 regulation of cell fate specification Biological Process

GO:0042742 defense response to bacterium Biological Process

KEGG gene cross-reference

ath:AT1G29860

ath:AT1G69310

ath:AT2G47260

ath:AT4G18170

ath:AT5G49520

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.968

Rank 1 · TkA01G050880 · TK1151

Cytoplasm0.114

Rank 2 · TkA01G050880 · TK1151

Cell membrane0.022

Rank 3 · TkA01G050880 · TK1151

Endoplasmic reticulum0.014

Rank 4 · TkA01G050880 · TK1151

Mitochondrion0.009

Rank 5 · TkA01G050880 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22251PFF1_TM10-86 aa

PF15761IMUP33-89 aa

PF10500SR-2539-90 aa

PF03106WRKY104-160 aa

PF10500SR-25125-145 aa

PF30553LPMO11_C125-136 aa

PF15761IMUP209-224 aa

PF10500SR-25210-224 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G050880	`PF22251`	PFF1_TM	10	86	0.53	10.5
TkA01G050880	`PF15761`	IMUP	33	89	0.0042	18.5
TkA01G050880	`PF10500`	SR-25	39	90	0.02	15.2
TkA01G050880	`PF03106`	WRKY	104	160	1.6e-21	77.0
TkA01G050880	`PF10500`	SR-25	125	145	0.02	15.2
TkA01G050880	`PF30553`	LPMO11_C	125	136	0.14	12.6
TkA01G050880	`PF15761`	IMUP	209	224	0.0042	18.5
TkA01G050880	`PF10500`	SR-25	210	224	0.02	15.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FGZ4`	Arabidopsis thaliana	sp\|Q9FGZ4\|WRK48_ARATH Probable WRKY transcription factor 48	52.500%	Swiss-Prot	Medium
`Q9C983`	Arabidopsis thaliana	sp\|Q9C983\|WRK57_ARATH Probable WRKY transcription factor 57	48.600%	Swiss-Prot	Medium
`Q93WV4`	Arabidopsis thaliana	sp\|Q93WV4\|WRK71_ARATH WRKY transcription factor 71	46.200%	Swiss-Prot	Medium
`Q8VWJ2`	Arabidopsis thaliana	sp\|Q8VWJ2\|WRK28_ARATH WRKY transcription factor 28	70.700%	Swiss-Prot	Low
`O22900`	Arabidopsis thaliana	sp\|O22900\|WRK23_ARATH WRKY transcription factor 23	46.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card