TkA01G048940 | RubberDandelionOmics

Gene overview

TkA01G048940

Reference: TK1151 Chr: Chr01 Coordinates: 12639532-12641721 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1887 bp · TkA01G048940|TK1151|cDNA

GTTTAACAAACGTAGATAGAAAGCAATAGACATTCCTATATTGTAACCCTAACTAAACAAGAGACCCCCGACGTTAGGGTTTAAGTCGAGAGCTTCAAGCCATCCACCATTTTTCTTGCAAAAATGGGGAAAAAACCCAAAGAGTCAAAAGCCGAAACCCCCAATTCATCTGCTTCAGCTCCATCGGACAATATTTTCAAATCCCTTTTCGGTGGCGGTCTAGAAGAACCCAACAATCCAACCTCCGATTCAATCTTCTC...

CDS

Download CDS FASTA

1566 bp · TkA01G048940|TK1151|CDS

ATGGGGAAAAAACCCAAAGAGTCAAAAGCCGAAACCCCCAATTCATCTGCTTCAGCTCCATCGGACAATATTTTCAAATCCCTTTTCGGTGGCGGTCTAGAAGAACCCAACAATCCAACCTCCGATTCAATCTTCTCGGATTCCAATCCTTTCCGAAGCAAACCCACCAATGAATCCCAATCAATTCCCCAAAAGCTCCAAGAAGTTCTCGGATTAGATATCGATAGTCCACAAAAGAACGCCTCCAAAATCCCCGATTC...

Protein

Download Protein FASTA

521 aa · TkA01G048940|TK1151|PROTEIN

MGKKPKESKAETPNSSASAPSDNIFKSLFGGGLEEPNNPTSDSIFSDSNPFRSKPTNESQSIPQKLQEVLGLDIDSPQKNASKIPDSANTLLSKRKRKEKLPESIKSDDSDIEGDVKKSKVEKGSTSSNVAEEKTKKKRKRSEVEAEYEERKYGAMDVDLKEDPEVKGKEKVGAKRKELESGEDQLVPKEGFDDEEKLLRTIFVGNLPLKVKKKALMREFNQFGEIESIRIRSIPLLDDKTPRKGAIMKKQINDAVDRVN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G048940`
TK1151 ID	TkA01G048940
OH-1004 ID	LXL04_030758
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	26.300
Protein coverage (%)	TK1151 31.478 / OH-1004 42.197 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G048940`
Location	Chr01:12639532-12641721 (+)
Description	Similar to 28 kDa ribonucleoprotein, chloroplastic
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_030758` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006396 RNA processing Biological Process GO:0006397 mRNA processing Biological Process GO:0009409 response to cold Biological Process GO:0009451 RNA modification Biological Process GO:0009631 cold acclimation Biological Process GO:0016553 base conversion or substitution editing Biological Process GO:0043489 RNA stabilization Biological Process GO:0045087 innate immune response Biological Process GO:1901259 chloroplast rRNA processing Biological Process GO:0005829 cytosol Cellular Component GO:0009507 chloroplast Cellular Component GO:0009535 chloroplast thylakoid membrane Cellular Component
KEGG gene cross-reference	ath:AT4G24770 ath:AT5G50250 nsy:104227036 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.957

Rank 1 · TkA01G048940 · TK1151

Cytoplasm0.080

Rank 2 · TkA01G048940 · TK1151

Cell membrane0.020

Rank 3 · TkA01G048940 · TK1151

Endoplasmic reticulum0.017

Rank 4 · TkA01G048940 · TK1151

Mitochondrion0.012

Rank 5 · TkA01G048940 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08895DUF1840102-142 aa

PF16367RRM_7151-169 aa

PF17799RRM_Rrp7195-223 aa

PF16367RRM_7200-277 aa

PF00076RRM_1202-233 aa

PF08895DUF1840234-277 aa

PF00076RRM_1258-287 aa

PF28441RRM_11258-290 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G048940	`PF08895`	DUF1840	102	142	1.9	9.5
TkA01G048940	`PF16367`	RRM_7	151	169	1.7e-10	41.4
TkA01G048940	`PF17799`	RRM_Rrp7	195	223	0.073	13.6
TkA01G048940	`PF16367`	RRM_7	200	277	1.7e-10	41.4
TkA01G048940	`PF00076`	RRM_1	202	233	3.1e-21	75.7
TkA01G048940	`PF08895`	DUF1840	234	277	1.9	9.5
TkA01G048940	`PF00076`	RRM_1	258	287	3.1e-21	75.7
TkA01G048940	`PF28441`	RRM_11	258	290	0.00013	23.0
TkA01G048940	`PF28442`	DUF8400	259	278	0.0081	17.0
TkA01G048940	`PF17799`	RRM_Rrp7	308	342	0.073	13.6
TkA01G048940	`PF16367`	RRM_7	311	388	1.7e-10	41.4
TkA01G048940	`PF00076`	RRM_1	313	386	3.1e-21	75.7
TkA01G048940	`PF28442`	DUF8400	313	383	0.0081	17.0
TkA01G048940	`PF28441`	RRM_11	317	390	0.00013	23.0
TkA01G048940	`PF07941`	K_channel_TID	414	424	5.4	8.3
TkA01G048940	`PF07941`	K_channel_TID	470	509	5.4	8.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card