TkA01G044460 | RubberDandelionOmics

Gene overview

TkA01G044460

Reference: TK1151 Chr: Chr01 Coordinates: 11500430-11501031 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

432 bp · TkA01G044460|TK1151|cDNA

ATGGCATCAAAGTGCAGTGTTTTAGTAGGTCTTTATCTTACTAACATCCTTTTATTGTTTGTCATAGTTACTGGTTGCGAGATCTCATCTAATCCTACCCACAACACTAATGTTAACTCATATCCCAGCAAACCGAATATGAATCCTTACTATAAGCCAAATCCTAGCAGCAACTATAACCCCAAGCCCACACCCCATCCTAACCCCTACCCAAATTCCACCCCAAACTCATTCCCAAGCCCAAATTCCAATGAAAACCC...

CDS

Download CDS FASTA

432 bp · TkA01G044460|TK1151|CDS

ATGGCATCAAAGTGCAGTGTTTTAGTAGGTCTTTATCTTACTAACATCCTTTTATTGTTTGTCATAGTTACTGGTTGCGAGATCTCATCTAATCCTACCCACAACACTAATGTTAACTCATATCCCAGCAAACCGAATATGAATCCTTACTATAAGCCAAATCCTAGCAGCAACTATAACCCCAAGCCCACACCCCATCCTAACCCCTACCCAAATTCCACCCCAAACTCATTCCCAAGCCCAAATTCCAATGAAAACCC...

Protein

Download Protein FASTA

143 aa · TkA01G044460|TK1151|PROTEIN

MASKCSVLVGLYLTNILLLFVIVTGCEISSNPTHNTNVNSYPSKPNMNPYYKPNPSSNYNPKPTPHPNPYPNSTPNSFPSPNSNENPNQNDLSTLRLLSVCALPSKPTCWESISMYHSLLACYLMLVETKSQMATIVPNSLHL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G044460`
TK1151 ID	TkA01G044460
OH-1004 ID	LXL04_005472
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	65.900
Protein coverage (%)	TK1151 28.671 / OH-1004 20.725 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G044460`
Location	Chr01:11500430-11501031 (+)
Description	Similar to EARLI1: Lipid transfer protein EARLI 1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_005472` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009409 response to cold Biological Process GO:0009626 plant-type hypersensitive response Biological Process GO:0009627 systemic acquired resistance Biological Process GO:0009631 cold acclimation Biological Process GO:0009651 response to salt stress Biological Process GO:0009682 induced systemic resistance Biological Process GO:0009737 response to abscisic acid Biological Process GO:0042742 defense response to bacterium Biological Process GO:0050832 defense response to fungus Biological Process GO:0070417 cellular response to cold Biological Process GO:0005576 extracellular region Cellular Component GO:0005783 endoplasmic reticulum Cellular Component
KEGG gene cross-reference	ath:AT4G12470 ath:AT4G12480 ath:AT4G12490 ath:AT4G12500 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.356

Rank 1 · TkA01G044460 · TK1151

Endoplasmic reticulum0.234

Rank 2 · TkA01G044460 · TK1151

Extracellular0.180

Rank 3 · TkA01G044460 · TK1151

Cytoplasm0.154

Rank 4 · TkA01G044460 · TK1151

Nucleus0.152

Rank 5 · TkA01G044460 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05887Trypan_PARP25-90 aa

PF07271Cytadhesin_P3041-89 aa

PF19939DUF640184-104 aa

PF19939DUF6401119-128 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G044460	`PF05887`	Trypan_PARP	25	90	0.003	18.2
TkA01G044460	`PF07271`	Cytadhesin_P30	41	89	8.3	6.7
TkA01G044460	`PF19939`	DUF6401	84	104	0.39	11.9
TkA01G044460	`PF19939`	DUF6401	119	128	0.39	11.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card