TkA01G042060 | RubberDandelionOmics

Gene overview

TkA01G042060

Reference: TK1151 Chr: Chr01 Coordinates: 10801295-10803133 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

993 bp · TkA01G042060|TK1151|cDNA

ATGAACAACTTTTCACACGTTCCTCCCGGTTTTAGATTCCATCCTACGGATGAAGAACTTGTAGATTATTACCTCAGAAAAAAGATTGCATCGAAAAGAATTGATCTTGATGTTATAAAAGACATTGATCTTTACAGAATTGAGCCATGGGACCTTCAAGATTTATGCAGGCTAGGAACCGAGGAGCAAAATGAATGGTATTTTTTTAGCCACAAGGATAAAAAGTACCCAACAGGAACTCGTACAAATAGGGCTACAAA...

CDS

Download CDS FASTA

993 bp · TkA01G042060|TK1151|CDS

ATGAACAACTTTTCACACGTTCCTCCCGGTTTTAGATTCCATCCTACGGATGAAGAACTTGTAGATTATTACCTCAGAAAAAAGATTGCATCGAAAAGAATTGATCTTGATGTTATAAAAGACATTGATCTTTACAGAATTGAGCCATGGGACCTTCAAGATTTATGCAGGCTAGGAACCGAGGAGCAAAATGAATGGTATTTTTTTAGCCACAAGGATAAAAAGTACCCAACAGGAACTCGTACAAATAGGGCTACAAA...

Protein

Download Protein FASTA

330 aa · TkA01G042060|TK1151|PROTEIN

MNNFSHVPPGFRFHPTDEELVDYYLRKKIASKRIDLDVIKDIDLYRIEPWDLQDLCRLGTEEQNEWYFFSHKDKKYPTGTRTNRATKAGFWKATGRDKAIYAKNNLVGMRKTLVFYKGRAPNGQKSDWIMHEYRLETNENGITQQEEGWVVCRVFKKRITTVRRMDEHDSLGWFDDQVSFMPNFESPRRITHPYSSNTSYQHHHFPTKSEIDQLPYNLPQDHSFLQLPQLESPKIQQHVSSTLQTSTQQLNINLLYGINS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G042060`
TK1151 ID	TkA01G042060
OH-1004 ID	LXL04_035329
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	57.400
Protein coverage (%)	TK1151 100.000 / OH-1004 97.354 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G042060

Location Chr01:10801295-10803133 (+)

Description Similar to NAC007: NAC domain-containing protein 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g12260`	Transcription activator that binds to the secondary wall NAC binding element (SNBE), 5'-(T/A)NN(C/T)(T/C/G)TNNNNNNNA(A/C)GN(A/C/T)(A/T)-3', in the promoter of target genes (By similarity).	Arabidopsis NAC domain proteins, VND1 to VND5, are transcriptional regulators of secondary wall biosynthesis in vessels.2014 · DOI: 10.1371/journal.pone.0105726
`At1g62700`	Transcription activator that binds to the secondary wall NAC binding element (SNBE), 5'-(T/A)NN(C/T)(T/C/G)TNNNNNNNA(A/C)GN(A/C/T)(A/T)-3', in the promoter of target genes (By similarity).	Arabidopsis NAC domain proteins, VND1 to VND5, are transcriptional regulators of secondary wall biosynthesis in vessels.2014 · DOI: 10.1371/journal.pone.0105726
`At2g18060`	Transcription activator that binds to the secondary wall NAC binding element (SNBE), 5'-(T/A)NN(C/T)(T/C/G)TNNNNNNNA(A/C)GN(A/C/T)(A/T)-3', in the promoter of target genes (By similarity).	Arabidopsis NAC domain proteins, VND1 to VND5, are transcriptional regulators of secondary wall biosynthesis in vessels.2014 · DOI: 10.1371/journal.pone.0105726
`At4g36160`	Transcription activator that binds to the secondary wall NAC binding element (SNBE), 5'-(T/A)NN(C/T)(T/C/G)TNNNNNNNA(A/C)GN(A/C/T)(A/T)-3', in the promoter of target genes (By similarity).	No verified direct reference in this release
`At5g62380`	Transcription activator that binds to the secondary wall NAC binding element (SNBE), 5'-(T/A)NN(C/T)(T/C/G)TNNNNNNNA(A/C)GN(A/C/T)(A/T)-3', and to the tracheary elements (TE) specific regulating cis-element (TERE), 5'-CTTNAAAGCNA-3', in the promoter of target genes (e.g. genes involved in secondary wall biosynthesis, cell wall modification such as xylan accumulation, and programmed cell death).	Transcription switches for protoxylem and metaxylem vessel formation.2005 · DOI: 10.1101/gad.1331305 A battery of transcription factors involved in the regulation of secondary cell wall biosynthesis in Arabidopsis.2008 · DOI: 10.1105/tpc.108.061325 ASYMMETRIC LEAVES2-LIKE19/LATERAL ORGAN BOUNDARIES DOMAIN30 and ASL20/LBD18 regulate tracheary element differentiation in Arabidopsis.2008 · DOI: 10.1105/tpc.108.061796 MYB58 and MYB63 are transcriptional activators of the lignin biosynthetic pathway during secondary cell wall formation in Arabidopsis.2009 · DOI: 10.1105/tpc.108.063321 MYB83 is a direct target of SND1 and acts redundantly with MYB46 in the regulation of secondary cell wall biosynthesis in Arabidopsis.2009 · DOI: 10.1093/pcp/pcp139 VASCULAR-RELATED NAC-DOMAIN6 and VASCULAR-RELATED NAC-DOMAIN7 effectively induce transdifferentiation into xylem vessel elements under control of an induction system.2010 · DOI: 10.1104/pp.110.154013 Global analysis of direct targets of secondary wall NAC master switches in Arabidopsis.2010 · DOI: 10.1093/mp/ssq062 Arabidopsis VASCULAR-RELATED NAC-DOMAIN6 directly regulates the genes that govern programmed cell death and secondary wall formation during xylem differentiation.2010 · DOI: 10.1105/tpc.110.075036

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035329 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009620 response to fungus Biological Process

GO:0009733 response to auxin Biological Process

GO:0009735 response to cytokinin Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009741 response to brassinosteroid Biological Process

GO:0010089 xylem development Biological Process

GO:0010981 regulation of cell wall macromolecule metabolic process Biological Process

GO:0043068 positive regulation of programmed cell death Biological Process

GO:0045491 xylan metabolic process Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

KEGG gene cross-reference

ath:AT1G12260

ath:AT1G62700

ath:AT2G18060

ath:AT4G36160

ath:AT5G62380

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.938

Rank 1 · TkA01G042060 · TK1151

Cytoplasm0.136

Rank 2 · TkA01G042060 · TK1151

Cell membrane0.042

Rank 3 · TkA01G042060 · TK1151

Endoplasmic reticulum0.035

Rank 4 · TkA01G042060 · TK1151

Plastid0.015

Rank 5 · TkA01G042060 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02365NAM8-135 aa

PF29201VOZ_C24-138 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G042060	`PF02365`	NAM	8	135	8.2e-49	165.9
TkA01G042060	`PF29201`	VOZ_C	24	138	0.0082	16.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FWX2`	Arabidopsis thaliana	sp\|Q9FWX2\|NAC7_ARATH NAC domain-containing protein 7	54.900%	Swiss-Prot	High
`F4HYV5`	Arabidopsis thaliana	sp\|F4HYV5\|NAC26_ARATH NAC domain-containing protein 26	58.600%	Swiss-Prot	High
`Q9SL41`	Arabidopsis thaliana	sp\|Q9SL41\|NAC37_ARATH NAC domain-containing protein 37	56.300%	Swiss-Prot	High
`O65508`	Arabidopsis thaliana	sp\|O65508\|NAC76_ARATH NAC domain-containing protein 76	55.100%	Swiss-Prot	High
`Q9LVA1`	Arabidopsis thaliana	sp\|Q9LVA1\|NC101_ARATH NAC domain-containing protein 101	50.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card