TkA01G037800 | RubberDandelionOmics

Gene overview

TkA01G037800

Reference: TK1151 Chr: Chr01 Coordinates: 9794699-9795656 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

762 bp · TkA01G037800|TK1151|cDNA

ATGTCGATTGTTAACTTCAACATTTTGGATATAACGCATACTGTTGAAAGAGATTGGACTGTCCTTGTTCAAGTTATTGCAATAGGACACACGCAGTTAAATAACGAATTACAAGAATATAGAAAGCTCCTATTCGCTGATGCACAGGGAACAATTGTGCCAGCAATAATCTTTCAATATCATCTAAAAACCTTTGACAAAATGTTCACACCATACCGAAAATATTATATTTCCAAAGCACAATTGATCAAATCAGACAC...

CDS

Download CDS FASTA

762 bp · TkA01G037800|TK1151|CDS

ATGTCGATTGTTAACTTCAACATTTTGGATATAACGCATACTGTTGAAAGAGATTGGACTGTCCTTGTTCAAGTTATTGCAATAGGACACACGCAGTTAAATAACGAATTACAAGAATATAGAAAGCTCCTATTCGCTGATGCACAGGGAACAATTGTGCCAGCAATAATCTTTCAATATCATCTAAAAACCTTTGACAAAATGTTCACACCATACCGAAAATATTATATTTCCAAAGCACAATTGATCAAATCAGACAC...

Protein

Download Protein FASTA

253 aa · TkA01G037800|TK1151|PROTEIN

MSIVNFNILDITHTVERDWTVLVQVIAIGHTQLNNELQEYRKLLFADAQGTIVPAIIFQYHLKTFDKMFTPYRKYYISKAQLIKSDTRFVDGPYEYTWSLIKKTHVIPHAEDAITHLPCIFNFTPFNQLYKFAGKNTCIRGVVIKCFPSQQITPGQPYSKRDIIVVNEEKRLMILTLWNSFDTLEGQALNQMIENAPIIYAMHIKVTTLYGKYFLFSTYYQNILNNSQIGLSMTTSTNSMTSFLLIASDIPTI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G037800`
TK1151 ID	TkA01G037800
OH-1004 ID	LXL04_016762
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	62.300
Protein coverage (%)	TK1151 81.028 / OH-1004 68.621 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G037800`
Location	Chr01:9794699-9795656 (+)
Description	Similar to RPA1B: Replication protein A 70 kDa DNA-binding subunit B
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_016762` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000722 telomere maintenance via recombination Biological Process GO:0000723 telomere maintenance Biological Process GO:0000724 double-strand break repair via homologous recombination Biological Process GO:0006260 DNA replication Biological Process GO:0006265 DNA topological change Biological Process GO:0006281 DNA repair Biological Process GO:0006289 nucleotide-excision repair Biological Process GO:0006312 mitotic recombination Biological Process GO:0007004 telomere maintenance via telomerase Biological Process GO:0007131 reciprocal meiotic recombination Biological Process GO:0010224 response to UV-B Biological Process GO:0010833 telomere maintenance via telomere lengthening Biological Process
KEGG gene cross-reference	ath:AT5G08020 ath:AT5G61000 dosa:Os03g0214100 sce:YAR007C These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.627

Rank 1 · TkA01G037800 · TK1151

Cytoplasm0.348

Rank 2 · TkA01G037800 · TK1151

Extracellular0.074

Rank 3 · TkA01G037800 · TK1151

Mitochondrion0.038

Rank 4 · TkA01G037800 · TK1151

Cell membrane0.029

Rank 5 · TkA01G037800 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02721DUF22317-128 aa

PF28721DUF844829-62 aa

PF16900REPA_OB_238-66 aa

PF18015Acetyltransf_1957-81 aa

PF28721DUF8448125-210 aa

PF16900REPA_OB_2139-212 aa

PF18015Acetyltransf_19164-202 aa

PF02721DUF223204-204 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G037800	`PF02721`	DUF223	17	128	0.00019	22.3
TkA01G037800	`PF28721`	DUF8448	29	62	0.011	16.5
TkA01G037800	`PF16900`	REPA_OB_2	38	66	0.00038	21.1
TkA01G037800	`PF18015`	Acetyltransf_19	57	81	0.25	12.3
TkA01G037800	`PF28721`	DUF8448	125	210	0.011	16.5
TkA01G037800	`PF16900`	REPA_OB_2	139	212	0.00038	21.1
TkA01G037800	`PF18015`	Acetyltransf_19	164	202	0.25	12.3
TkA01G037800	`PF02721`	DUF223	204	204	0.00019	22.3
TkA01G037800	`PF18015`	Acetyltransf_19	211	247	0.25	12.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card