TkA01G035820 | RubberDandelionOmics

Gene overview

TkA01G035820

Reference: TK1151 Chr: Chr01 Coordinates: 9291883-9294987 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2775 bp · TkA01G035820|TK1151|cDNA

AGCTTTCATTATAGCTTTGAAGAAACATATAGTAACTCTACAACAATCATATTTTACACCTTTATAAAGTATCCAATTTCAGTCTCCCCTCTACGGCGGAGCATCCACTCACAGTCGCACACTTGCTGTCTACCACCACCGCCATCACCACCGTCGCAATCGCCATGATATTTCTCATCCTCTCTCACACACTTACTTCACGCTCACTGCGTGTGTTCATAGTACCAACGATGCAAAGCAATGGCATGGCCCCATCGATA...

CDS

Download CDS FASTA

1935 bp · TkA01G035820|TK1151|CDS

ATGGCAGCTACTGTCTCTTCAGACAACCATAAAATTCATCTACAGAAAAAGCCCAGCTCCAGTATTAAGTTCAGACGCCGGCGGATCAAAGAAACCACTATTTCATCCACCATCGTAAACCACCAGCAACACCCGTCTGTTGTGTCACCGGAAAACAGTTCTTGGTGCTGCCCGTCGGCCGTGTCCTCCCACAAACCGGTACCTCAACGTCCTACGCTGCAAACAAGCCATCAACAACTCAGTTCGGATTCTCCGGTGGT...

Protein

Download Protein FASTA

644 aa · TkA01G035820|TK1151|PROTEIN

MAATVSSDNHKIHLQKKPSSSIKFRRRRIKETTISSTIVNHQQHPSVVSPENSSWCCPSAVSSHKPVPQRPTLQTSHQQLSSDSPVVSASRESLIEESSLSIEKSVILASDSPVNLDRTTMTTTTAVYGGGSNHQETFPSSFTNFNSALTAGLLNPMSPPPPTSDKTRSSPTLFEMMANEPDCKIPNNSNGNASLSYPTPKKPNNHVIPPPPIIIDKQALLQQRLLDLLSIRSPGSQYNDPNSSDVKLTLTSKDGLSVSM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G035820`
TK1151 ID	TkA01G035820
OH-1004 ID	LXL04_005544
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G035820

Location Chr01:9291883-9294987 (+)

Description Similar to At1g63850: BTB/POZ domain-containing protein At1g63850

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g63850`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At5g60050`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At3g50780`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At2g13690`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At3g05675`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005544 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0016567 protein ubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G63850

ath:AT2G13690

ath:AT3G05675

ath:AT3G50780

ath:AT5G60050

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.652

Rank 1 · TkA01G035820 · TK1151

Cytoplasm0.283

Rank 2 · TkA01G035820 · TK1151

Cell membrane0.130

Rank 3 · TkA01G035820 · TK1151

Endoplasmic reticulum0.052

Rank 4 · TkA01G035820 · TK1151

Lysosome / Vacuole0.042

Rank 5 · TkA01G035820 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02731SKIP_SNW14-65 aa

PF00651BTB244-328 aa

PF02731SKIP_SNW381-444 aa

PF25553BTB-POZ_ANK-like402-626 aa

PF14920MTBP_C416-463 aa

PF07631PSD4418-443 aa

PF07631PSD4463-512 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G035820	`PF02731`	SKIP_SNW	14	65	1.0	9.7
TkA01G035820	`PF00651`	BTB	244	328	0.12	13.2
TkA01G035820	`PF02731`	SKIP_SNW	381	444	1.0	9.7
TkA01G035820	`PF25553`	BTB-POZ_ANK-like	402	626	5e-58	197.1
TkA01G035820	`PF14920`	MTBP_C	416	463	0.074	14.2
TkA01G035820	`PF07631`	PSD4	418	443	0.021	16.1
TkA01G035820	`PF07631`	PSD4	463	512	0.021	16.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9CAJ9`	Arabidopsis thaliana	sp\|Q9CAJ9\|Y1385_ARATH BTB/POZ domain-containing protein At1g63850	67.700%	Swiss-Prot	High
`Q9LVG9`	Arabidopsis thaliana	sp\|Q9LVG9\|Y5600_ARATH BTB/POZ domain-containing protein At5g60050	43.000%	Swiss-Prot	Medium
`Q9SVM0`	Arabidopsis thaliana	sp\|Q9SVM0\|Y3078_ARATH BTB/POZ domain-containing protein At3g50780	47.400%	Swiss-Prot	Medium
`Q9SKH2`	Arabidopsis thaliana	sp\|Q9SKH2\|Y2369_ARATH BTB/POZ domain-containing protein At2g13690	32.200%	Swiss-Prot	Medium
`Q8RX01`	Arabidopsis thaliana	sp\|Q8RX01\|Y3567_ARATH BTB/POZ domain-containing protein At3g05675	23.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card