TkA01G023860 | RubberDandelionOmics

Gene overview

TkA01G023860

Reference: TK1151 Chr: Chr01 Coordinates: 6151754-6157559 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3935 bp · TkA01G023860|TK1151|cDNA

GGAGGATAGAATTTTTTTTTTCTTTTTTTGGTTTTTTAAATAAAGTCATTTAAAAAAATCTAAAAGAAATTAGAAACGGTAAAATAACGATATGACAAAGTTACGTAGAAATACCATTCTTCAAAATTTTTCTACCCACGAGGACGAGCCATGTATTTTTTGATAAGAAAAAAAAAAATATTTTAATGAGTATTGATGGTTCGAGCAAAGCAAGAATTGGCGGTCTTCATTTGAGATTCAAATGCATCCTTTGAACTGTT...

CDS

Download CDS FASTA

3342 bp · TkA01G023860|TK1151|CDS

ATGGCGTCAGGCACCTCATGCTCCCGCGTTGATCAGTTCTATCATTCAAAGAAGAAACATAAGTTTGTATCACCCATTTTAAAATCTGGAACAATCGAACAAAATGCAAATTCTTCACTTGAAGGGTCATCTTATAAGCAAGATCAAGTAAGAAGAAATCTAATATCAGAGATAGAATCATCTTCAAGATATAAACACATGGAAACTATATCAACTATCCAGGGGCATCAAAGGGAGAATATGAAGCATATAATTGGAGG...

Protein

Download Protein FASTA

1113 aa · TkA01G023860|TK1151|PROTEIN

MASGTSCSRVDQFYHSKKKHKFVSPILKSGTIEQNANSSLEGSSYKQDQVRRNLISEIESSSRYKHMETISTIQGHQRENMKHIIGGLSNKRKGNDRPSVLDLEDKSNKKMHLSSIKETNVGNKLSLRKCIRTSMEAVDVTSCNTPRRQIVKLATEESPQSMHGSSIVSPGDAFWKEALQVFDEMSNHNKHLYEHVEEPKGYGQFEINHIDDVSNQSNDNRSCNTPSIDIKSCDVDILKSVESTSSSCVLSNDPLDIENW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G023860`
TK1151 ID	TkA01G023860
OH-1004 ID	LXL04_005682
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G023860

Location Chr01:6151754-6157559 (+)

Description Similar to TEB: Helicase and polymerase-containing protein TEBICHI

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g32700`	Required for regulated cell division and differentiation in meristems and embryos, thus modulating adaxial-abaxial polarity.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005682 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0000731 DNA synthesis involved in DNA repair Biological Process

GO:0006261 DNA-templated DNA replication Biological Process

GO:0006281 DNA repair Biological Process

GO:0006284 base-excision repair Biological Process

GO:0006302 double-strand break repair Biological Process

GO:0006974 DNA damage response Biological Process

GO:0009640 photomorphogenesis Biological Process

GO:0009933 meristem structural organization Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0010792 DNA double-strand break processing involved in repair via single-strand annealing Biological Process

GO:0031297 replication fork processing Biological Process

KEGG gene cross-reference

ath:AT4G32700

dme:Dmel_CG6019

hsa:10721

hsa:113510

mmu:77782

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.821

Rank 1 · TkA01G023860 · TK1151

Cytoplasm0.205

Rank 2 · TkA01G023860 · TK1151

Mitochondrion0.038

Rank 3 · TkA01G023860 · TK1151

Plastid0.032

Rank 4 · TkA01G023860 · TK1151

Cell membrane0.030

Rank 5 · TkA01G023860 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04851ResIII77-119 aa

PF00270DEAD289-445 aa

PF04851ResIII292-442 aa

PF00271Helicase_C315-362 aa

PF22527DEXQc_Suv3365-413 aa

PF00271Helicase_C503-536 aa

PF00271Helicase_C584-658 aa

PF20470HTH_61663-754 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G023860	`PF04851`	ResIII	77	119	8.1e-05	23.3
TkA01G023860	`PF00270`	DEAD	289	445	2.8e-25	89.7
TkA01G023860	`PF04851`	ResIII	292	442	8.1e-05	23.3
TkA01G023860	`PF00271`	Helicase_C	315	362	5.2e-13	49.9
TkA01G023860	`PF22527`	DEXQc_Suv3	365	413	0.16	12.2
TkA01G023860	`PF00271`	Helicase_C	503	536	5.2e-13	49.9
TkA01G023860	`PF00271`	Helicase_C	584	658	5.2e-13	49.9
TkA01G023860	`PF20470`	HTH_61	663	754	1.9e-26	93.0
TkA01G023860	`PF21099`	POLQ_helical	778	956	5.6e-51	173.5
TkA01G023860	`PF00270`	DEAD	868	932	2.8e-25	89.7
TkA01G023860	`PF21280`	Helicase_dom4_arc	882	959	0.2	12.2
TkA01G023860	`PF25453`	DUF7898	963	1005	5e-07	30.8
TkA01G023860	`PF14520`	HHH_5	966	1003	0.2	12.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q588V7`	Arabidopsis thaliana	sp\|Q588V7\|TEB_ARATH Helicase and polymerase-containing protein TEBICHI	72.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card