TkA01G023370 | RubberDandelionOmics

Gene overview

TkA01G023370

Reference: TK1151 Chr: Chr01 Coordinates: 5997669-6000842 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1679 bp · TkA01G023370|TK1151|cDNA

CACAACTTCCAAACCGGTTCCGACCGGCTTACGTAATACGGATGCGTGTAACCAAGAGCGTAGTGCTCGATTATCCCTTCAAAATCCCTAATTCTTCCTCCTTCCCCTTCGTTACAAATCCTAAATCTGAAACTTCAATTATCGAACAGAAACCCCTCTATATTCTAATTCAATTCCAACTCTTCGGTTGCAAGTGTTCACCTTTTTGTTGTTGCAGAGAGCAATTTATCCCTGGGTGTTCGAATGGTCCCGATTGATTC...

CDS

Download CDS FASTA

1212 bp · TkA01G023370|TK1151|CDS

ATGGTCCCGATTGATTCTTCCGGAGTTGTAATGGTAGAAGAGAAGGAGCAGCAACACAACGCGAAACGACGCCGGCTTACATGGGATGTGGCAGCATCCCCAGCACAGGCTGAAGTAAGGCAGCCGATGCCATGTCGCAAACCCTCCTCACCAAAAAGAGAAGATGATCGTGAGGGACATTATACGTACAGTCTTGGAGAGAATCTAACTCCAAGATATAAAATACTGAGCAAGATGGGTGAAGGCACCTTTGGTCGAGT...

Protein

Download Protein FASTA

403 aa · TkA01G023370|TK1151|PROTEIN

MVPIDSSGVVMVEEKEQQHNAKRRRLTWDVAASPAQAEVRQPMPCRKPSSPKREDDREGHYTYSLGENLTPRYKILSKMGEGTFGRVLECWDRETRGYVAIKVVRSIRKYRDAAMIEVDVLQQLAKNHKGRSHCVQILNWFDYRNHICIVFEKLGPSLFDFLKRNKYCPFPLDLVREIGRQLLESVAYMHSLHLIHTDLKPENILLVSSDYLKLPGYKRTLGESNFRWLPKSSEIKLIDFGSTAYDNQNHSSIVSTRHYR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G023370`
TK1151 ID	TkA01G023370
OH-1004 ID	LXL04_032736
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	64.000
Protein coverage (%)	TK1151 93.548 / OH-1004 93.088 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G023370

Location Chr01:5997669-6000842 (+)

Description Similar to AFC1: Serine/threonine-protein kinase AFC1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g32660`	Serine/threonine-protein kinase AFC3.	No verified direct reference in this release
`At3g53570`	Activator of yeast transcription factor, STE12.	No verified direct reference in this release
`At4g24740`	Serine/threonine-protein kinase AFC2.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032736 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006397 mRNA processing Biological Process

GO:0006468 protein phosphorylation Biological Process

GO:0010212 response to ionizing radiation Biological Process

GO:0018108 peptidyl-tyrosine phosphorylation Biological Process

GO:0032526 response to retinoic acid Biological Process

GO:0043484 regulation of RNA splicing Biological Process

GO:0045721 negative regulation of gluconeogenesis Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT3G53570

ath:AT4G24740

ath:AT4G32660

hsa:1196

mmu:12748

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.736

Rank 1 · TkA01G023370 · TK1151

Cytoplasm0.355

Rank 2 · TkA01G023370 · TK1151

Cell membrane0.050

Rank 3 · TkA01G023370 · TK1151

Mitochondrion0.037

Rank 4 · TkA01G023370 · TK1151

Endoplasmic reticulum0.027

Rank 5 · TkA01G023370 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase73-398 aa

PF07714PK_Tyr_Ser-Thr75-306 aa

PF06293Kdo149-208 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G023370	`PF00069`	Pkinase	73	398	1.8e-53	182.3
TkA01G023370	`PF07714`	PK_Tyr_Ser-Thr	75	306	1.9e-18	67.5
TkA01G023370	`PF06293`	Kdo	149	208	0.018	15.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P51568`	Arabidopsis thaliana	sp\|P51568\|AFC3_ARATH Serine/threonine-protein kinase AFC3	70.600%	Swiss-Prot	High
`P51566`	Arabidopsis thaliana	sp\|P51566\|AFC1_ARATH Serine/threonine-protein kinase AFC1	68.900%	Swiss-Prot	High
`P51567`	Arabidopsis thaliana	sp\|P51567\|AFC2_ARATH Serine/threonine-protein kinase AFC2	66.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card