TkA01G022040 | RubberDandelionOmics

Gene overview

TkA01G022040

Reference: TK1151 Chr: Chr01 Coordinates: 5654314-5655818 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1409 bp · TkA01G022040|TK1151|cDNA

AAAAAAGAAAGAAGAGCATGTGGTGTCCCCTTTTCCTTTTAACAATCGCCATCTATATAATAGGTCCCTCCTTCAAGAAAGGTAGCTAAGCCAGATTGATGGAAGGGGAGATGATGATAACGATGATGACAATGAATGGAAGAACAACAACAACCACCACCACCTTCCATGAAAAAGATCATTCTTTCTCCACCCTAATATCTACCCCAACCTGGAAATTATACGAAAATCCATCCTACACTTGTCCTAATCCTCAAACC...

CDS

Download CDS FASTA

918 bp · TkA01G022040|TK1151|CDS

ATGGAAGGGGAGATGATGATAACGATGATGACAATGAATGGAAGAACAACAACAACCACCACCACCTTCCATGAAAAAGATCATTCTTTCTCCACCCTAATATCTACCCCAACCTGGAAATTATACGAAAATCCATCCTACACTTGTCCTAATCCTCAAACCCACAATCAAAATCACGAAAAGAAACAACAAGAATTACAAAATCAGGTGGATCACAATAAGAACCAACTCCATCTTCTTCATTTACCCGTATCTAATCG...

Protein

Download Protein FASTA

305 aa · TkA01G022040|TK1151|PROTEIN

MEGEMMITMMTMNGRTTTTTTTFHEKDHSFSTLISTPTWKLYENPSYTCPNPQTHNQNHEKKQQELQNQVDHNKNQLHLLHLPVSNRKLASSFWDLTFIKPLMDSELDAARAQIKELKSQLDHERKARKKAESVNKKLMKELKGRESLEKACEELSAEITYNRAELTRLKKDMEEERKMMRVAEVLREERVQMKLTDAKIMLEEKLSELETTKGIHNGDEDKNKINKSIVVRENRNFIFGNSVKLEAENPHIKRGIRGFV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G022040`
TK1151 ID	TkA01G022040
OH-1004 ID	LXL04_005717
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G022040

Location Chr01:5654314-5655818 (+)

Description Similar to BLT: Protein BRANCHLESS TRICHOME

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g64690`	Acts as a key regulator of trichome branching.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005717 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0010090 trichome morphogenesis Biological Process

GO:0010091 trichome branching Biological Process

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT1G64690

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.564

Rank 1 · TkA01G022040 · TK1151

Nucleus0.373

Rank 2 · TkA01G022040 · TK1151

Cell membrane0.182

Rank 3 · TkA01G022040 · TK1151

Endoplasmic reticulum0.049

Rank 4 · TkA01G022040 · TK1151

Plastid0.031

Rank 5 · TkA01G022040 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14362DUF440755-186 aa

PF08702Fib_alpha58-81 aa

PF07303Occludin_ELL62-77 aa

PF08702Fib_alpha99-200 aa

PF07303Occludin_ELL104-174 aa

PF16523betaPIX_CC106-144 aa

PF07303Occludin_ELL153-191 aa

PF16523betaPIX_CC155-184 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G022040	`PF14362`	DUF4407	55	186	0.0018	18.4
TkA01G022040	`PF08702`	Fib_alpha	58	81	1.8	9.5
TkA01G022040	`PF07303`	Occludin_ELL	62	77	5.5	8.5
TkA01G022040	`PF08702`	Fib_alpha	99	200	1.8	9.5
TkA01G022040	`PF07303`	Occludin_ELL	104	174	5.5	8.5
TkA01G022040	`PF16523`	betaPIX_CC	106	144	1.2	9.7
TkA01G022040	`PF07303`	Occludin_ELL	153	191	5.5	8.5
TkA01G022040	`PF16523`	betaPIX_CC	155	184	1.2	9.7
TkA01G022040	`PF16523`	betaPIX_CC	197	205	1.2	9.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4I878`	Arabidopsis thaliana	sp\|F4I878\|BLT_ARATH Protein BRANCHLESS TRICHOME	35.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card