TkA01G020610 | RubberDandelionOmics

Gene overview

TkA01G020610

Reference: TK1151 Chr: Chr01 Coordinates: 5319353-5332210 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3262 bp · TkA01G020610|TK1151|cDNA

CTATGATCCAAATCTATAAAATTTGTACAAAACCCCCTCCGTTACAATGTCTATCTACATGAGTTCTTGAAACTGTCATCTAAGATTGTGAAGCCTATCCAGGAACAGGAAGCATGGCAGCCACACCCAATCCCACACTGATTTATTCTCCAAAATCCTCGATTCACCTCACGAAAATTCAATTTTACGTTCGCTCCAACCCCTTCAGATCGTCTTCATCATCGAGGTCTGGTTCATTCGCGGTCAAATGCAGTAGCCCC...

CDS

Download CDS FASTA

1986 bp · TkA01G020610|TK1151|CDS

ATGGAGATTGAAAGAGAGAGTAATTCAGAAACTGGAGAAGAGAAGAAAGATGATGATTATGATCATGATTTTGAAGCTTCAAAAAGACAGCAGCCATGGAGAAAACAGATCACAATTCGGGGAGTTATTGCAAGTGTTATATTAGGAACTGTTTATACAGTTATAGCCATGAAACTAAATCTCACAACTGGTTTGATTCCTAATCTGAATGTCTCAGCTGCACTTCTTGCTTTCATGTACATGAAAACATGGACAAAGAT...

Protein

Download Protein FASTA

661 aa · TkA01G020610|TK1151|PROTEIN

MEIERESNSETGEEKKDDDYDHDFEASKRQQPWRKQITIRGVIASVILGTVYTVIAMKLNLTTGLIPNLNVSAALLAFMYMKTWTKILQKLGFRFVPFTRHENTMIQTCSIACYSIAIGGGFGSYLFALNKKTYELAGGVNSPGTYKELHIGWMIGYSFLISFAGLFVLIPLRKILIIDYKLVFPSGMATAVLINGFHSQGDDMAKKQIKGFAKYFSVSFLWAIFQWFFSGKGGCGFAHFPTFGLEAWKKTFYFDFSLTY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G020610`
TK1151 ID	TkA01G020610
OH-1004 ID	LXL04_005725
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	95.100
Protein coverage (%)	TK1151 93.192 / OH-1004 57.704 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G020610

Location Chr01:5319353-5332210 (+)

Description Similar to YSL3: Metal-nicotianamine transporter YSL3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g53550`	May be involved in the lateral transport of nicotianamine- chelated metals in the vasculature.	Mutations in Arabidopsis yellow stripe-like1 and yellow stripe-like3 reveal their roles in metal ion homeostasis and loading of metal ions in seeds.2006 · DOI: 10.1104/pp.106.082586
`At4g24120`	Involved in iron loading of the seeds.	A loss-of-function mutation in AtYSL1 reveals its role in iron and nicotianamine seed loading.2005 · DOI: 10.1111/j.1365-313x.2005.02569.x Mutations in Arabidopsis yellow stripe-like1 and yellow stripe-like3 reveal their roles in metal ion homeostasis and loading of metal ions in seeds.2006 · DOI: 10.1104/pp.106.082586
`At5g24380`	May be involved in the lateral transport of nicotianamine- chelated metals in the vasculature.	Arabidopsis Yellow Stripe-Like2 (YSL2): a metal-regulated gene encoding a plasma membrane transporter of nicotianamine-metal complexes.2004 · DOI: 10.1111/j.1365-313x.2004.02128.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0542200`	May be involved in the transport of nicotianamine-chelated metals.	No verified direct reference in this release
`Os04g0542800`	May be involved in the transport of nicotianamine-chelated metals.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005725 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0003006 developmental process involved in reproduction Biological Process

GO:0006811 monoatomic ion transport Biological Process

GO:0006826 iron ion transport Biological Process

GO:0009624 response to nematode Biological Process

GO:0010039 response to iron ion Biological Process

GO:0010043 response to zinc ion Biological Process

GO:0048316 seed development Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0035673 oligopeptide transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT4G24120

ath:AT5G24380

ath:AT5G53550

dosa:Os04g0542200

dosa:Os04g0542800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.405

Rank 1 · TkA01G020610 · TK1151

Lysosome / Vacuole0.287

Rank 2 · TkA01G020610 · TK1151

Endoplasmic reticulum0.179

Rank 3 · TkA01G020610 · TK1151

Cytoplasm0.068

Rank 4 · TkA01G020610 · TK1151

Golgi apparatus0.063

Rank 5 · TkA01G020610 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03169OPT36-645 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G020610	`PF03169`	OPT	36	645	1.3e-142	477.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q2EF88`	Arabidopsis thaliana	sp\|Q2EF88\|YSL3_ARATH Metal-nicotianamine transporter YSL3	61.800%	Swiss-Prot	High
`Q6R3L0`	Arabidopsis thaliana	sp\|Q6R3L0\|YSL1_ARATH Metal-nicotianamine transporter YSL1	62.800%	Swiss-Prot	High
`Q6R3K9`	Arabidopsis thaliana	sp\|Q6R3K9\|YSL2_ARATH Metal-nicotianamine transporter YSL2	61.600%	Swiss-Prot	High
`Q7XUJ2`	Oryza sativa subsp. japonica	sp\|Q7XUJ2\|YSL9_ORYSJ Probable metal-nicotianamine transporter YSL9	60.700%	Swiss-Prot	High
`Q7XN54`	Oryza sativa subsp. japonica	sp\|Q7XN54\|YSL16_ORYSJ Probable metal-nicotianamine transporter YSL16	60.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card