TkA01G016340 | RubberDandelionOmics

Gene overview

TkA01G016340

Reference: TK1151 Chr: Chr01 Coordinates: 4165401-4166693 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1014 bp · TkA01G016340|TK1151|cDNA

ATGACTGGTCACTACACTCCTCGCGACTTCGTTCTCTCGATTCAGAAGCCCCGATCTGTGATAATCTTAGTAAAGGCTGGCGCGCCGGTTGACCAGACGATTGAGGCGTTGGCGGCTCATATGGAACCCGGGGACACCATCATCGACGGGGGGAACGAGTGGTACGAGAACACCGAGCGGCGAATTGTTGAAGCTGAGCAGAAAGGTTTGCTTTATCTCGGAATGGGAGTCTCCGGCGGCGAAGAAGGCGCGAGAAATGG...

CDS

Download CDS FASTA

1014 bp · TkA01G016340|TK1151|CDS

ATGACTGGTCACTACACTCCTCGCGACTTCGTTCTCTCGATTCAGAAGCCCCGATCTGTGATAATCTTAGTAAAGGCTGGCGCGCCGGTTGACCAGACGATTGAGGCGTTGGCGGCTCATATGGAACCCGGGGACACCATCATCGACGGGGGGAACGAGTGGTACGAGAACACCGAGCGGCGAATTGTTGAAGCTGAGCAGAAAGGTTTGCTTTATCTCGGAATGGGAGTCTCCGGCGGCGAAGAAGGCGCGAGAAATGG...

Protein

Download Protein FASTA

337 aa · TkA01G016340|TK1151|PROTEIN

MTGHYTPRDFVLSIQKPRSVIILVKAGAPVDQTIEALAAHMEPGDTIIDGGNEWYENTERRIVEAEQKGLLYLGMGVSGGEEGARNGPSLMPGGSYEAYNNIKDIVEKVAAQVEDGPCVTYIGEGGSGNFVKMVHNGIEYGDMQLISEAYDVLKNIGGLTNAELAEVFDEWNRGELESFLIEITADIFKVQDEHSEGYLVDKVLDKTGMKGTGKWTVQQAAELSIAVPTIAASLDCRFLSGLKSEREDAAKVLAEAGLTE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G016340`
TK1151 ID	TkA01G016340
OH-1004 ID	LXL04_013447
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	58.600
Protein coverage (%)	TK1151 99.110 / OH-1004 75.536 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G016340

Location Chr01:4165401-4166693 (+)

Description Similar to PGD2: 6-phosphogluconate dehydrogenase, decarboxylating 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g64190`	Catalyzes the oxidative decarboxylation of 6-phosphogluconate to ribulose 5-phosphate and CO(2), with concomitant reduction of NADP to NADPH.	No verified direct reference in this release
`At5g41670`	Catalyzes the oxidative decarboxylation of 6-phosphogluconate to ribulose 5-phosphate and CO(2), with concomitant reduction of NADP to NADPH.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0111500`	Catalyzes the oxidative decarboxylation of 6-phosphogluconate to ribulose 5-phosphate and CO(2), with concomitant reduction of NADP to NADPH.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013447 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009051 pentose-phosphate shunt, oxidative branch Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009744 response to sucrose Biological Process

GO:0009749 response to glucose Biological Process

GO:0009750 response to fructose Biological Process

GO:0019521 D-gluconate metabolic process Biological Process

GO:0080173 male-female gamete recognition during double fertilization forming a zygote and endosperm Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT1G64190

ath:AT3G02360

ath:AT5G41670

dosa:Os06g0111500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.745

Rank 1 · TkA01G016340 · TK1151

Nucleus0.300

Rank 2 · TkA01G016340 · TK1151

Peroxisome0.069

Rank 3 · TkA01G016340 · TK1151

Plastid0.062

Rank 4 · TkA01G016340 · TK1151

Mitochondrion0.062

Rank 5 · TkA01G016340 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03446NAD_binding_23-123 aa

PF003936PGD128-296 aa

PF11486DUF3212150-202 aa

PF06413Neugrin214-275 aa

PF003936PGD298-330 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G016340	`PF03446`	NAD_binding_2	3	123	1.4e-30	107.2
TkA01G016340	`PF00393`	6PGD	128	296	2.1e-78	264.3
TkA01G016340	`PF11486`	DUF3212	150	202	0.27	12.2
TkA01G016340	`PF06413`	Neugrin	214	275	0.014	15.7
TkA01G016340	`PF00393`	6PGD	298	330	2.1e-78	264.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SH69`	Arabidopsis thaliana	sp\|Q9SH69\|6PGD1_ARATH 6-phosphogluconate dehydrogenase, decarboxylating 1, chloroplastic	65.800%	Swiss-Prot	High
`Q9FFR3`	Arabidopsis thaliana	sp\|Q9FFR3\|6PGD3_ARATH 6-phosphogluconate dehydrogenase, decarboxylating 3, chloroplastic	65.600%	Swiss-Prot	High
`Q9LI00`	Oryza sativa subsp. japonica	sp\|Q9LI00\|6PGD1_ORYSJ 6-phosphogluconate dehydrogenase, decarboxylating 1	58.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card