TkA01G007920 | RubberDandelionOmics

Gene overview

TkA01G007920

Reference: TK1151 Chr: Chr01 Coordinates: 2073280-2078116 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2642 bp · TkA01G007920|TK1151|cDNA

AAATACGACCCTTCTGGCAGCCAATAGCCATGGCCCCACCACGTCCATCACAGAACGCTGACTCCAGGGAGGAGTAGGTGTTAAGGTGTTCCTTTCTCCTCACAATCATTCTCTTCTCCGCTAATCAACCACCCAACTGCCGCCACCAACCGCCACCAACCATCACCAACTTAGGTCATATCACTTTTCCCCAATAATTACATACAATCAAAATGGATAATCCCCCTCCGCCGTCTTCACCGTCTCCCCCACCACCTCCA...

CDS

Download CDS FASTA

2247 bp · TkA01G007920|TK1151|CDS

ATGGATAATCCCCCTCCGCCGTCTTCACCGTCTCCCCCACCACCTCCACCATCGGCTTTGCACATGGACTCGATCGACGAGTCGTCGACTTTGATTTGGGACTGGAGTCAGTTCCTCGATTTCAACATTGACGATCACTTGCCGTTACCCGGAGAAGAAGAATCCAACCACTCCCCCGCGATTCCAACATCCCAGGAACTCTATCCGATTGACAATTCTGAGGTAGAGCCGGTACCCGATTCGTTCCCGGTCAATTCGAC...

Protein

Download Protein FASTA

748 aa · TkA01G007920|TK1151|PROTEIN

MDNPPPPSSPSPPPPPPSALHMDSIDESSTLIWDWSQFLDFNIDDHLPLPGEEESNHSPAIPTSQELYPIDNSEVEPVPDSFPVNSTSDTNDRVRKRDPRMACSNFLAGRIPCACPELDALLLAEEDEAAPGKKKSRATSTRTAASSRCQVPACGVDISELKGYHKRHRVCLRCANASTVVLDGLNKRYCQQCGKFHILSDFDEGKRSCRRKLERHNNRRRRKPSDSKNPGTQSADYDDGYDESGKGTKCTSSEAAGEKP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G007920`
TK1151 ID	TkA01G007920
OH-1004 ID	LXL04_005906
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G007920

Location Chr01:2073280-2078116 (+)

Description Similar to SPL7: Squamosa promoter-binding-like protein 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g18830`	Transcription factor that participates in reprogramming global gene expression during copper deficiency in order to improve the metal uptake and prioritize its distribution to copper proteins of major importance (Probable).	SQUAMOSA Promoter Binding Protein-Like7 Is a Central Regulator for Copper Homeostasis in Arabidopsis.2009 · DOI: 10.1105/tpc.108.060137 Transcriptome sequencing identifies SPL7-regulated copper acquisition genes FRO4/FRO5 and the copper dependence of iron homeostasis in Arabidopsis.2012 · DOI: 10.1105/tpc.111.090431 MicroRNA408 is critical for the HY5-SPL7 gene network that mediates the coordinated response to light and copper.2014 · DOI: 10.1105/tpc.114.127340 Toxicity responses of Cu and Cd: the involvement of miRNAs and the transcription factor SPL7.2016 · DOI: 10.1186/s12870-016-0830-4

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0408200`	Trans-acting factor that binds specifically to the consensus nucleotide sequence 5'-TNCGTACAA-3'.	No verified direct reference in this release
`Os01g0292900`	Trans-acting factor that binds specifically to the consensus nucleotide sequence 5'-TNCGTACAA-3'.	No verified direct reference in this release
`UniProt: A2YX04`	Trans-acting factor that binds specifically to the consensus nucleotide sequence 5'-TNCGTACAA-3'.	No verified direct reference in this release
`Os08g0513700`	Trans-acting factor that binds specifically to the consensus nucleotide sequence 5'-TNCGTACAA-3'.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005906 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006878 intracellular copper ion homeostasis Biological Process

GO:0035874 cellular response to copper ion starvation Biological Process

GO:0048638 regulation of developmental growth Biological Process

GO:0055070 copper ion homeostasis Biological Process

GO:0005634 nucleus Cellular Component

GO:0016607 nuclear speck Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0001216 DNA-binding transcription activator activity Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

KEGG gene cross-reference

ath:AT2G47070

ath:AT5G18830

dosa:Os01g0292900

dosa:Os05g0408200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.554

Rank 1 · TkA01G007920 · TK1151

Cytoplasm0.276

Rank 2 · TkA01G007920 · TK1151

Cell membrane0.208

Rank 3 · TkA01G007920 · TK1151

Endoplasmic reticulum0.108

Rank 4 · TkA01G007920 · TK1151

Golgi apparatus0.049

Rank 5 · TkA01G007920 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03110SBP149-223 aa

PF26102Ig_SPL7422-530 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G007920	`PF03110`	SBP	149	223	3.4e-28	98.5
TkA01G007920	`PF26102`	Ig_SPL7	422	530	9e-38	129.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8S9G8`	Arabidopsis thaliana	sp\|Q8S9G8\|SPL7_ARATH Squamosa promoter-binding-like protein 7	44.100%	Swiss-Prot	Medium
`Q6I576`	Oryza sativa subsp. japonica	sp\|Q6I576\|SPL9_ORYSJ Squamosa promoter-binding-like protein 9	42.400%	Swiss-Prot	Medium
`Q9LGU7`	Oryza sativa subsp. japonica	sp\|Q9LGU7\|SPL1_ORYSJ Squamosa promoter-binding-like protein 1	27.800%	Swiss-Prot	Low
`A2YX04`	Oryza sativa subsp. indica	sp\|A2YX04\|SPL15_ORYSI Squamosa promoter-binding-like protein 15	26.200%	Swiss-Prot	Low
`Q6Z8M8`	Oryza sativa subsp. japonica	sp\|Q6Z8M8\|SPL15_ORYSJ Squamosa promoter-binding-like protein 15	26.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card