Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2420 bp · TkA01G006550|TK1151|cDNA
GAGAACGTAAGGTATATACCACGCGTATAAATATTAGGTTTGGCCAAATTGTATGAAAGAGAAACGCACAAACCACAATTGAAGACAGTAGGTGGGGGTATCTCTATCTCTCTCTCATCTAAGAGCCTGGAGTTAGGCTTTTTGCCCTGCTGTGGCTACCTTAAGCTTATGCCGTTTGCCCTACACCAGCTTGGAAAGGTTGTAATATTTTCTGAAACATGGAGCAAGTGTGCCTTTTGTCAGATTGTTTCCAGAGACAG...
1338 bp · TkA01G006550|TK1151|CDS
ATGGAAAGGTATAAGATAATTAAGGAAGTTGGTAATGGGACATTTGGGGTAGTTTGGCGTGCATTGAATAGGCATACTGGTGAAGTGGTTGCTATCAAGAAAATGAAGAGAAAATATTATACATGGGAAGAATGCATTAATTTGAGAGAAGTCAAGTCTCTGCGAAAGATGAATCATCCAAATATTGTGAAGCTGAAGGAAGTCATCAGAGAAAATGACATTTTGTACTTTGTGTTTGAATACATGGAATGCAGTCTTTA...
Protein
Download Protein FASTA445 aa · TkA01G006550|TK1151|PROTEIN
MERYKIIKEVGNGTFGVVWRALNRHTGEVVAIKKMKRKYYTWEECINLREVKSLRKMNHPNIVKLKEVIRENDILYFVFEYMECSLYQLMKDRLKPFSETEIRNWCFSVFQGLVYMQQHGYFHRDLKPENLLVSKGVIKIADFGLAREITSQPPYTEYVSTRWYRAPEVLLQSPTYGSAVDSWAMGAIMAELFTLHPLFPGSSEADEIYKICSVIGSPTESTWREGLELASTINYQFPQVSGVNLSAIIPSASKEGIDLI...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA01G006550 |
|---|---|
| TK1151 ID | TkA01G006550 |
| OH-1004 ID | LXL04_000455 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 57.700 |
| Protein coverage (%) | TK1151 64.944 / OH-1004 94.822Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA01G006550 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr01:1690987-1696135 (+) | |||||||||
| Description | Similar to CDKF-4: Cyclin-dependent kinase F-4 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. Rice
| |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006351 DNA-templated transcription Biological Process GO:0006468 protein phosphorylation Biological Process GO:0007283 spermatogenesis Biological Process GO:0030154 cell differentiation Biological Process GO:0035556 intracellular signal transduction Biological Process GO:0042073 intraciliary transport Biological Process GO:0045494 photoreceptor cell maintenance Biological Process GO:0046777 protein autophosphorylation Biological Process GO:0060271 cilium assembly Biological Process GO:1902856 negative regulation of non-motile cilium assembly Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component | |||||||||
| KEGG gene cross-reference | ath:AT4G13020 dosa:Os02g0700600 dosa:Os03g0847600 hsa:4117 rno:25677 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00069Pkinase4-283 aaPF07714PK_Tyr_Ser-Thr5-195 aaPF03109ABC112-35 aaPF12330Haspin_kinase78-148 aaPF03109ABC180-151 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA01G006550 | PF00069 | Pkinase | 4 | 283 | 3.6e-72 | 243.6 |
| TkA01G006550 | PF07714 | PK_Tyr_Ser-Thr | 5 | 195 | 1e-36 | 127.3 |
| TkA01G006550 | PF03109 | ABC1 | 12 | 35 | 0.0015 | 18.4 |
| TkA01G006550 | PF12330 | Haspin_kinase | 78 | 148 | 0.11 | 12.2 |
| TkA01G006550 | PF03109 | ABC1 | 80 | 151 | 0.0015 | 18.4 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.