TkA01G005840 | RubberDandelionOmics

Gene overview

TkA01G005840

Reference: TK1151 Chr: Chr01 Coordinates: 1450554-1453139 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1341 bp · TkA01G005840|TK1151|cDNA

ATGATGCTTTCCCATTACAGACATGAAAATATCGTCCACCTCCTCGGATTTTGCAACGGGGTTCGTGAGAAGATCCTTGTGTACGAGCATGCAGCTCATGGAAGTCTTGATGTCCATTTGAGTAGCACTACTCTGACGTGGACTCAACGACTCAATATATGTCTTGGGGCCGCAAGGGGACTGTGCTACCTGCATGATCCCAAGGAGACACACGAAAGAGTTATCCATAGGGATATAAAAAGTGCCAACATTCTCTTAGA...

CDS

Download CDS FASTA

1341 bp · TkA01G005840|TK1151|CDS

ATGATGCTTTCCCATTACAGACATGAAAATATCGTCCACCTCCTCGGATTTTGCAACGGGGTTCGTGAGAAGATCCTTGTGTACGAGCATGCAGCTCATGGAAGTCTTGATGTCCATTTGAGTAGCACTACTCTGACGTGGACTCAACGACTCAATATATGTCTTGGGGCCGCAAGGGGACTGTGCTACCTGCATGATCCCAAGGAGACACACGAAAGAGTTATCCATAGGGATATAAAAAGTGCCAACATTCTCTTAGA...

Protein

Download Protein FASTA

446 aa · TkA01G005840|TK1151|PROTEIN

MMLSHYRHENIVHLLGFCNGVREKILVYEHAAHGSLDVHLSSTTLTWTQRLNICLGAARGLCYLHDPKETHERVIHRDIKSANILLDENWNAKIADMGLSKRGPANQGQSFVATNVAGTLFYADPEYMETSILTKESDVYSFGVVLLEVLCGTLCFEMKNGIPRRLVQRWVQRYENKKLEEIIFYPLRQGMDRKSSDTFSEIVYECLVKPHAQRPSMSHVVEKIEIALHFQEEFSKMELEKMLRSERYFNKEIFEKAEFQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G005840`
TK1151 ID	TkA01G005840
OH-1004 ID	LXL04_005760
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	60.600
Protein coverage (%)	TK1151 81.839 / OH-1004 55.263 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G005840

Location Chr01:1450554-1453139 (-)

Description Similar to At5g38990: Probable receptor-like protein kinase At5g38990

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g46290`	Receptor-like protein kinase required for cell elongation during vegetative growth, mostly in a brassinosteroid-(BR-) independent manner.	Three related receptor-like kinases are required for optimal cell elongation in Arabidopsis thaliana.2009 · DOI: 10.1073/pnas.0812346106
`At5g38990`	Probable receptor-like protein kinase At5g38990.	No verified direct reference in this release
`At5g59700`	Probable receptor-like protein kinase At5g59700.	No verified direct reference in this release
`At5g39000`	Putative receptor-like protein kinase At5g39000.	No verified direct reference in this release
`At5g54380`	Receptor-like protein kinase required for cell elongation during vegetative growth, mostly in a brassinosteroid-(BR-) independent manner.	A receptor-like kinase mediates the response of Arabidopsis cells to the inhibition of cellulose synthesis.2007 · DOI: 10.1016/j.cub.2007.05.018 Three related receptor-like kinases are required for optimal cell elongation in Arabidopsis thaliana.2009 · DOI: 10.1073/pnas.0812346106

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005760 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009723 response to ethylene Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009741 response to brassinosteroid Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0009788 negative regulation of abscisic acid-activated signaling pathway Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0010038 response to metal ion Biological Process

GO:0010118 stomatal movement Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0010483 pollen tube reception Biological Process

KEGG gene cross-reference

ath:AT3G46290

ath:AT3G51550

ath:AT5G28680

ath:AT5G38990

ath:AT5G39000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.550

Rank 1 · TkA01G005840 · TK1151

Nucleus0.311

Rank 2 · TkA01G005840 · TK1151

Cell membrane0.206

Rank 3 · TkA01G005840 · TK1151

Endoplasmic reticulum0.095

Rank 4 · TkA01G005840 · TK1151

Golgi apparatus0.057

Rank 5 · TkA01G005840 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase2-222 aa

PF07714PK_Tyr_Ser-Thr2-224 aa

PF13384HTH_23161-179 aa

PF13518HTH_28161-180 aa

PF29418DUF3723_N228-284 aa

PF00069Pkinase252-279 aa

PF14874PapD-like334-367 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G005840	`PF00069`	Pkinase	2	222	1.5e-34	120.4
TkA01G005840	`PF07714`	PK_Tyr_Ser-Thr	2	224	1.9e-34	119.9
TkA01G005840	`PF13384`	HTH_23	161	179	0.041	14.4
TkA01G005840	`PF13518`	HTH_28	161	180	0.28	12.0
TkA01G005840	`PF29418`	DUF3723_N	228	284	0.034	15.0
TkA01G005840	`PF00069`	Pkinase	252	279	1.5e-34	120.4
TkA01G005840	`PF14874`	PapD-like	334	367	0.31	11.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LX66`	Arabidopsis thaliana	sp\|Q9LX66\|HERK_ARATH Receptor-like protein kinase HERK 1	46.400%	Swiss-Prot	Medium
`Q9FID9`	Arabidopsis thaliana	sp\|Q9FID9\|Y5389_ARATH Probable receptor-like protein kinase At5g38990	45.600%	Swiss-Prot	Medium
`Q9FN92`	Arabidopsis thaliana	sp\|Q9FN92\|Y5597_ARATH Probable receptor-like protein kinase At5g59700	46.900%	Swiss-Prot	Medium
`Q9FID8`	Arabidopsis thaliana	sp\|Q9FID8\|Y5900_ARATH Putative receptor-like protein kinase At5g39000	44.400%	Swiss-Prot	Medium
`Q9LK35`	Arabidopsis thaliana	sp\|Q9LK35\|THE1_ARATH Receptor-like protein kinase THESEUS 1	45.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card