TkA01G000480 | RubberDandelionOmics

Gene overview

TkA01G000480

Reference: TK1151 Chr: Chr01 Coordinates: 107079-109356 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1335 bp · TkA01G000480|TK1151|cDNA

CTTGAACTACATTTTTCCCTCTTTCTCCTCCAAACCCTTCGTCTCTGTTTCAAAGCTGCACGGAGACTCATCAATGGTTGACGACGCGGGGAGTTCATCCACGGCTCTATCGAAGGAAGACAAGCCTGTGATAGTTAGGGTTAAACGGAAAAGCTATCAGTCGCCGCTCGAAGCTTTTTGGCTTGAAATCAATGAAAGACCAGTGAAGCGGCCATTGTTGGATTTTGAGAAACTATCCATCAACAATTCAGCGTCCCAAG...

CDS

Download CDS FASTA

1047 bp · TkA01G000480|TK1151|CDS

ATGGTTGACGACGCGGGGAGTTCATCCACGGCTCTATCGAAGGAAGACAAGCCTGTGATAGTTAGGGTTAAACGGAAAAGCTATCAGTCGCCGCTCGAAGCTTTTTGGCTTGAAATCAATGAAAGACCAGTGAAGCGGCCATTGTTGGATTTTGAGAAACTATCCATCAACAATTCAGCGTCCCAAGTTGAGGAATCGAAGCCCAAAAAGTTTTTTGTGCAACATGTGGATACTGTGAGCAGCTCTGATGTTACTGTTGA...

Protein

Download Protein FASTA

348 aa · TkA01G000480|TK1151|PROTEIN

MVDDAGSSSTALSKEDKPVIVRVKRKSYQSPLEAFWLEINERPVKRPLLDFEKLSINNSASQVEESKPKKFFVQHVDTVSSSDVTVDVLQSFVASKPTSTDTLDSKSKPEDQRRSNKTEIDNKQKQLLVKAKESQELLAKNARFEQIWKRRKGKEDTGASDNALRDMCHFYDVVRVDTGETSGVHEQDDEEDERLMHSFLPLLREFIPSAADDIESEFDHQVIKKASKDEYVYDLYAVKDDKMVVVEENTSSPFPFVQVN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G000480`
TK1151 ID	TkA01G000480
OH-1004 ID	LXL04_036627
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	91.800
Protein coverage (%)	TK1151 100.000 / OH-1004 99.735 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G000480

Location Chr01:107079-109356 (-)

Description Similar to RDM4: RNA-directed DNA methylation 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g30280`	Probable regulatory factor for several RNA polymerases.	A conserved transcriptional regulator is required for RNA-directed DNA methylation and plant development.2009 · DOI: 10.1101/gad.1851809 RNA-directed DNA methylation and plant development require an IWR1-type transcription factor.2010 · DOI: 10.1038/embor.2009.246

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036627 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0080188 gene silencing by siRNA-directed DNA methylation Biological Process

GO:0005634 nucleus Cellular Component

GO:0003700 DNA-binding transcription factor activity Molecular Function

KEGG gene cross-reference

ath:AT2G30280

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.940

Rank 1 · TkA01G000480 · TK1151

Cytoplasm0.201

Rank 2 · TkA01G000480 · TK1151

Mitochondrion0.023

Rank 3 · TkA01G000480 · TK1151

Cell membrane0.016

Rank 4 · TkA01G000480 · TK1151

Endoplasmic reticulum0.008

Rank 5 · TkA01G000480 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23824DUF719469-150 aa

PF08574Iwr1147-147 aa

PF08574Iwr1229-293 aa

PF08574Iwr1292-311 aa

PF08574Iwr1320-347 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G000480	`PF23824`	DUF7194	69	150	0.053	13.7
TkA01G000480	`PF08574`	Iwr1	147	147	4e-06	28.4
TkA01G000480	`PF08574`	Iwr1	229	293	4e-06	28.4
TkA01G000480	`PF08574`	Iwr1	292	311	4e-06	28.4
TkA01G000480	`PF08574`	Iwr1	320	347	4e-06	28.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GYP3`	Arabidopsis thaliana	sp\|Q8GYP3\|RDM4_ARATH RNA-directed DNA methylation 4	47.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card