LXL04_039774 | RubberDandelionOmics

Gene overview

LXL04_039774

Reference: OH-1004 Chr: JAJTUU010000039.1 Coordinates: 271533-273340 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

504 bp · LXL04_039774|LXL04_039774|OH1004|cDNA

ATGGCAAACGATTGGGGAGATCGCTCAAAGCCTGCTTCTCGAATTACCTTCTTCCCCTCACCAGAAATGGTTGCTGCTTTCTTAGTGAAAGATCCAAAGAATTGCCCCTCTTCGGAAAAGCTCTTGAAGCACCCGCTCTTTAAGCATGCAAAAACATGTGATTATTTGGAACGTACTATTCTTGATGGTCTTTCTCCATTAGGTGATTGTTTTAGGATGCTAAAGgCCAAAGAAGGTGATCTTCTTGTACAGAACAAGGA...

CDS

Download CDS FASTA

504 bp · LXL04_039774|LXL04_039774|OH1004|CDS

ATGGCAAACGATTGGGGAGATCGCTCAAAGCCTGCTTCTCGAATTACCTTCTTCCCCTCACCAGAAATGGTTGCTGCTTTCTTAGTGAAAGATCCAAAGAATTGCCCCTCTTCGGAAAAGCTCTTGAAGCACCCGCTCTTTAAGCATGCAAAAACATGTGATTATTTGGAACGTACTATTCTTGATGGTCTTTCTCCATTAGGTGATTGTTTTAGGATGCTAAAGGCCAAAGAAGGTGATCTTCTTGTACAGAACAAGGA...

Protein

Download Protein FASTA

167 aa · LXL04_039774|LXL04_039774|OH1004|PROTEIN

MANDWGDRSKPASRITFFPSPEMVAAFLVKDPKNCPSSEKLLKHPLFKHAKTCDYLERTILDGLSPLGDCFRMLKAKEGDLLVQNKDLYGDKDHLSKQEYIRGISAWNFNLEDLKNQATLRNDLDEISSVEDPKTTEQQNGVNGVTVTVTSPQEKVSPEIHNDNHFQ

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_039774`
TK1151 ID	TkA04G351330
OH-1004 ID	LXL04_039774
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	95.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_039774

Location JAJTUU010000039.1:271533-273340 (-)

Description Similar to BLUS1: Serine/threonine-protein kinase BLUS1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g14480`	Ser/Thr protein kinase mediating a primary step for phototropin signaling in guard cells.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039774 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:1902456 regulation of stomatal opening Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0043539 protein serine/threonine kinase activator activity Molecular Function

GO:0046872 metal ion binding Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT4G14480

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.541

Rank 1 · LXL04_039774 · OH-1004

Nucleus0.372

Rank 2 · LXL04_039774 · OH-1004

Cell membrane0.131

Rank 3 · LXL04_039774 · OH-1004

Mitochondrion0.089

Rank 4 · LXL04_039774 · OH-1004

Golgi apparatus0.069

Rank 5 · LXL04_039774 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O23304`	Arabidopsis thaliana	Serine/threonine-protein kinase BLUS1	35.417%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card