LXL04_039733 | RubberDandelionOmics

Gene overview

LXL04_039733

Reference: OH-1004 Chr: JAJTUU010000033.1 Coordinates: 166404-167987 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1161 bp · LXL04_039733|LXL04_039733|OH1004|cDNA

ATGGGTGATAAGAATGTGGTGGTTTCATCAAACATTAAGCTTGAAAGGCTTCTTAGTATGAAAGGAGGCAAAGGCGAAGCCAGTTATGCCAACAACTCTCAAGCCCAGGCAAAGCATGCTCGATCAATGTTACACCTTCTGAAGGAAACGCTCGACGGTGTTCgcctgaactcgccggagatACCCTTTGTGGTGGCGGATCTTGGTTGCTCCAGCGGAAGCAACACCATCTTCATCGTCAATGTCATCATCCAACACAT...

CDS

Download CDS FASTA

1161 bp · LXL04_039733|LXL04_039733|OH1004|CDS

ATGGGTGATAAGAATGTGGTGGTTTCATCAAACATTAAGCTTGAAAGGCTTCTTAGTATGAAAGGAGGCAAAGGCGAAGCCAGTTATGCCAACAACTCTCAAGCCCAGGCAAAGCATGCTCGATCAATGTTACACCTTCTGAAGGAAACGCTCGACGGTGTTCGCCTGAACTCGCCGGAGATACCCTTTGTGGTGGCGGATCTTGGTTGCTCCAGCGGAAGCAACACCATCTTCATCGTCAATGTCATCATCCAACACAT...

Protein

Download Protein FASTA

386 aa · LXL04_039733|LXL04_039733|OH1004|PROTEIN

MGDKNVVVSSNIKLERLLSMKGGKGEASYANNSQAQAKHARSMLHLLKETLDGVRLNSPEIPFVVADLGCSSGSNTIFIVNVIIQHITKRYEASGLSDLPEFSAFFADLPSNDFNTLFQLLPPLANQDVGSMEECLASTGHRSFFAAGVPGSFYRRLFPARSVDVFYSAFSLHWLSQVPEIVLEKSSTTYNKGKIFIHGANKSTANAYRRQFQTDLAGFLKMRSKEMKMGGSMFIALLGRTSEDPTDQGGAGLLFGTHFQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_039733`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_039733

Location JAJTUU010000033.1:166404-167987 (-)

Description Similar to IAMT1: Indole-3-acetate O-methyltransferase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g55250`	Catalyzes the methylation of the free carboxyl end of the plant hormone indole-3-acetic acid (IAA).	An indole-3-acetic acid carboxyl methyltransferase regulates Arabidopsis leaf development.2005 · DOI: 10.1105/tpc.105.034959 The possible action mechanisms of indole-3-acetic acid methyl ester in Arabidopsis.2008 · DOI: 10.1007/s00299-007-0458-9
`At5g56300`	Methylates the carboxyl group of several gibberellins (GAs).	Methylation of gibberellins by Arabidopsis GAMT1 and GAMT2.2007 · DOI: 10.1105/tpc.106.044602
`At4g26420`	Methylates the carboxyl group of several gibberellins (GAs).	Methylation of gibberellins by Arabidopsis GAMT1 and GAMT2.2007 · DOI: 10.1105/tpc.106.044602

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0665200`	Catalyzes the methylation of the free carboxyl end of the plant hormone indole-3-acetic acid (IAA).	Structural, biochemical, and phylogenetic analyses suggest that indole-3-acetic acid methyltransferase is an evolutionarily ancient member of the SABATH family.2008 · DOI: 10.1104/pp.107.110049

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039733 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009851 auxin biosynthetic process Biological Process

GO:0009856 pollination Biological Process

GO:0009944 polarity specification of adaxial/abaxial axis Biological Process

GO:0032259 methylation Biological Process

GO:0140964 intracellular auxin homeostasis Biological Process

GO:0000287 magnesium ion binding Molecular Function

GO:0008168 methyltransferase activity Molecular Function

GO:0008757 S-adenosylmethionine-dependent methyltransferase activity Molecular Function

GO:0010341 gibberellin carboxyl-O-methyltransferase activity Molecular Function

GO:0042802 identical protein binding Molecular Function

GO:0046872 metal ion binding Molecular Function

GO:0051749 indole acetic acid carboxyl methyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT4G26420

ath:AT5G55250

ath:AT5G56300

dosa:Os04g0665200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.739

Rank 1 · LXL04_039733 · OH-1004

Nucleus0.300

Rank 2 · LXL04_039733 · OH-1004

Plastid0.096

Rank 3 · LXL04_039733 · OH-1004

Endoplasmic reticulum0.061

Rank 4 · LXL04_039733 · OH-1004

Cell membrane0.055

Rank 5 · LXL04_039733 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03492.23Methyltransf_716-383 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_039733	`PF03492.23`	Methyltransf_7	16	383	8.5e-114	381.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FLN8`	Arabidopsis thaliana	Indole-3-acetate O-methyltransferase 1	69.923%	Swiss-Prot	strong database homology
`Q5XF78`	Arabidopsis thaliana	Gibberellic acid methyltransferase 2	38.802%	Swiss-Prot	moderate database homology
`F4JUY5`	Arabidopsis thaliana	Gibberellic acid methyltransferase 1	37.209%	Swiss-Prot	moderate database homology
`Q0J998`	Oryza sativa subsp. japonica	Indole-3-acetate O-methyltransferase 1	61.364%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card