LXL04_039283 | RubberDandelionOmics

Gene overview

LXL04_039283

Reference: OH-1004 Chr: Chr09 Coordinates: 64425963-64439425 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1668 bp · LXL04_039283|LXL04_039283|OH1004|cDNA

ATGAACACGAACGAAGCCAGCACTTCCGGCGGCGGTAAATTTCACACCGTGCAGCCTCTTCGCGACTTAAAATCAAATTGGGAGGTAGATCTTGCCAATGATCTCCAAGAGTATTTGCTTAAGATCTGCTCCGGTGAGATTACTGGCGGTGAAGATGATACTGCGTTGCTGCTTCAAGGTTCAATTCAGGTGTACAGCCGGAAGGTTGAATATCTCTATTCTTTGGTTGTTCATGCTTTGGAGTTCATCTCTCAACAGAG...

CDS

Download CDS FASTA

1668 bp · LXL04_039283|LXL04_039283|OH1004|CDS

ATGAACACGAACGAAGCCAGCACTTCCGGCGGCGGTAAATTTCACACCGTGCAGCCTCTTCGCGACTTAAAATCAAATTGGGAGGTAGATCTTGCCAATGATCTCCAAGAGTATTTGCTTAAGATCTGCTCCGGTGAGATTACTGGCGGTGAAGATGATACTGCGTTGCTGCTTCAAGGTTCAATTCAGGTGTACAGCCGGAAGGTTGAATATCTCTATTCTTTGGTTGTTCATGCTTTGGAGTTCATCTCTCAACAGAG...

Protein

Download Protein FASTA

555 aa · LXL04_039283|LXL04_039283|OH1004|PROTEIN

MNTNEASTSGGGKFHTVQPLRDLKSNWEVDLANDLQEYLLKICSGEITGGEDDTALLLQGSIQVYSRKVEYLYSLVVHALEFISQQSQQHDKPDNTPDAEEENDRSKDNNTPLNSHVKPPGNLVVLEGDCLDTSGDNGELESYLIICFECVICWYSSSSSVFLYSLSFDTACWHSIICYTIYAHMHTGTAHFADHDPIGESAGPMRRLYSRGFIGSPRELVTTAVSRGHRTTPVGIGPDVTGPYGVSGCAPLIREFISYS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_039283`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_039283

Location Chr09:64425963-64439425 (+)

Description Similar to CAPH2: Condensin-2 complex subunit H2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g16730`	Regulatory subunit of the condensin-2 complex, a complex that seems to provide chromosomes with an additional level of organization and rigidity and in establishing mitotic chromosome architecture (By similarity).	Condensin II alleviates DNA damage and is essential for tolerance of boron overload stress in Arabidopsis.2011 · DOI: 10.1105/tpc.111.086314

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039283 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006974 DNA damage response Biological Process

GO:0007076 mitotic chromosome condensation Biological Process

GO:0007143 female meiotic nuclear division Biological Process

GO:0010032 meiotic chromosome condensation Biological Process

GO:0010172 embryonic body morphogenesis Biological Process

GO:0045739 positive regulation of DNA repair Biological Process

GO:0051306 mitotic sister chromatid separation Biological Process

GO:0051309 female meiosis chromosome separation Biological Process

GO:0051984 positive regulation of chromosome segregation Biological Process

GO:1905820 positive regulation of chromosome separation Biological Process

GO:1905821 positive regulation of chromosome condensation Biological Process

GO:0000793 condensed chromosome Cellular Component

KEGG gene cross-reference

ath:AT3G16730

hsa:29781

mmu:52683

xtr:733729

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.831

Rank 1 · LXL04_039283 · OH-1004

Cytoplasm0.252

Rank 2 · LXL04_039283 · OH-1004

Mitochondrion0.037

Rank 3 · LXL04_039283 · OH-1004

Cell membrane0.028

Rank 4 · LXL04_039283 · OH-1004

Endoplasmic reticulum0.018

Rank 5 · LXL04_039283 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06278.17CNDH2_N14-109 aa

PF16869.11CNDH2_M363-477 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_039283	`PF06278.17`	CNDH2_N	14	109	1.2e-30	106.6
LXL04_039283	`PF16869.11`	CNDH2_M	363	477	1.6e-17	65.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LUR0`	Arabidopsis thaliana	Condensin-2 complex subunit H2	50.588%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card