LXL04_039190 | RubberDandelionOmics

Gene overview

LXL04_039190

Reference: OH-1004 Chr: Chr09 Coordinates: 61961393-61966959 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1953 bp · LXL04_039190|LXL04_039190|OH1004|cDNA

ATGATTTCAACTTGGTACAGGAATCAAATGGCTTTACTGAGAGTGCATTATCCAACTGGAGTTATGGAAACACAACAGTACAGTAAAAATTTGGTGACAAGACCAAGTTGTTTGCCCCAAATGCGCCGAGTCCACAGAAAAAGGACAGAAATGAGGTGTTTGGTGGCGAAAGAGGGTGTATCGGAATTGGAAGATTTGGATTCATTGGAGGGAGAAGAATTCAGCCATGTCACCAAGTTTAAGTTATCGGATTTTAAGAT...

CDS

Download CDS FASTA

1953 bp · LXL04_039190|LXL04_039190|OH1004|CDS

ATGATTTCAACTTGGTACAGGAATCAAATGGCTTTACTGAGAGTGCATTATCCAACTGGAGTTATGGAAACACAACAGTACAGTAAAAATTTGGTGACAAGACCAAGTTGTTTGCCCCAAATGCGCCGAGTCCACAGAAAAAGGACAGAAATGAGGTGTTTGGTGGCGAAAGAGGGTGTATCGGAATTGGAAGATTTGGATTCATTGGAGGGAGAAGAATTCAGCCATGTCACCAAGTTTAAGTTATCGGATTTTAAGAT...

Protein

Download Protein FASTA

650 aa · LXL04_039190|LXL04_039190|OH1004|PROTEIN

MISTWYRNQMALLRVHYPTGVMETQQYSKNLVTRPSCLPQMRRVHRKRTEMRCLVAKEGVSELEDLDSLEGEEFSHVTKFKLSDFKMSDRISIGLGGRGDEVVSEAIINDISSPLHNTRVVLRRLTSAQAQRRGKRAMQVLKKLCRRKVMYHSYSMQVHGYVTEDDGSFTLVHGYHGGFSLRHWLRQADWLPTLEATLALDEESVRRVGDDTVGGPAVSRHLRVTRILMRDLLIGVNYLHSHGLAHTELRLENLHISPLD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_039190`
TK1151 ID	TkA04G514470
OH-1004 ID	LXL04_039190
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.300
Protein coverage (%)	TK1151 100.000 / OH-1004 98.615 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_039190

Location Chr09:61961393-61966959 (+)

Description Similar to PAP14: Probable plastid-lipid-associated protein 14, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g53450`	May be directly regulated by DOF3.6/OBP3, while its specific function remains unclear.	Target genes for OBP3, a Dof transcription factor, include novel basic helix-loop-helix domain proteins inducible by salicylic acid.2003 · DOI: 10.1046/j.1365-313x.2003.01812.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039190 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006970 response to osmotic stress Biological Process

GO:0032968 positive regulation of transcription elongation by RNA polymerase II Biological Process

GO:0000307 cyclin-dependent protein kinase holoenzyme complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0008353 RNA polymerase II CTD heptapeptide repeat kinase activity Molecular Function

KEGG gene cross-reference

ath:AT5G53450

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.905

Rank 1 · LXL04_039190 · OH-1004

Mitochondrion0.083

Rank 2 · LXL04_039190 · OH-1004

Nucleus0.046

Rank 3 · LXL04_039190 · OH-1004

Cytoplasm0.038

Rank 4 · LXL04_039190 · OH-1004

Cell membrane0.020

Rank 5 · LXL04_039190 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LV04`	Arabidopsis thaliana	Probable plastid-lipid-associated protein 14, chloroplastic	63.666%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card