LXL04_038901 | RubberDandelionOmics

Gene overview

LXL04_038901

Reference: OH-1004 Chr: Chr09 Coordinates: 52887139-52890585 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1272 bp · LXL04_038901|LXL04_038901|OH1004|cDNA

ATGGGGTTGGAGGATGCAGATCTCGTAGATGATGGAGATGCTGCCGGAGGAGGAAAAGCTGCTTTGTCGGTTTCATGCTCGATTTGCCTCGAGGTTGTCACCGATAACGGAGATCGTGCTTGGGCAAAGCTCCAATGCGGCCATCAATTTCATCTAGATTGCATTGGGTCTGCATTTAATGTGAAGGGAGTGATGCAATGTCCCAACTGTAGGAAAATTGAGAAAGGTCAATGGCTTTATGCAAATGGGTGTCGACCATA...

CDS

Download CDS FASTA

1272 bp · LXL04_038901|LXL04_038901|OH1004|CDS

ATGGGGTTGGAGGATGCAGATCTCGTAGATGATGGAGATGCTGCCGGAGGAGGAAAAGCTGCTTTGTCGGTTTCATGCTCGATTTGCCTCGAGGTTGTCACCGATAACGGAGATCGTGCTTGGGCAAAGCTCCAATGCGGCCATCAATTTCATCTAGATTGCATTGGGTCTGCATTTAATGTGAAGGGAGTGATGCAATGTCCCAACTGTAGGAAAATTGAGAAAGGTCAATGGCTTTATGCAAATGGGTGTCGACCATA...

Protein

Download Protein FASTA

423 aa · LXL04_038901|LXL04_038901|OH1004|PROTEIN

MGLEDADLVDDGDAAGGGKAALSVSCSICLEVVTDNGDRAWAKLQCGHQFHLDCIGSAFNVKGVMQCPNCRKIEKGQWLYANGCRPYPEFSMDDWTHDEDLYDLSYSESSMWCPFGGFTRLAASFDEGEFPTTAYHDIVGQHAIFTEHAAVSSATHLCPYIAYVQPVHPSSSSSTSSASVGDGGGGGGGSGPYNTNNQWNNNNNHSQSASSDMANSYGLPSMAMDVRYHTLFPASTARVDQPSISSVMSRRPVRSNPNAA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_038901`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_038901

Location Chr09:52887139-52890585 (+)

Description Similar to RFI2: E3 ubiquitin-protein ligase RFI2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g47700`	Mediates phytochrome (phyA and phyB)-controlled seedling deetiolation responses such as hypocotyl elongation in response to red and far-red light.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0350900`	Functions as an E3 ligase that promotes polyubiquitination of SPL14/IPA1 for subsequent proteasomal degradation.	Tissue-Specific Ubiquitination by IPA1 INTERACTING PROTEIN1 Modulates IPA1 Protein Levels to Regulate Plant Architecture in Rice.2017 · DOI: 10.1105/tpc.16.00879

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038901 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007623 circadian rhythm Biological Process

GO:0009585 red, far-red light phototransduction Biological Process

GO:0009908 flower development Biological Process

GO:0010114 response to red light Biological Process

GO:0010218 response to far red light Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0010629 negative regulation of gene expression Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0048450 floral organ structural organization Biological Process

GO:0080050 regulation of seed development Biological Process

GO:0090227 regulation of red or far-red light signaling pathway Biological Process

GO:2000028 regulation of photoperiodism, flowering Biological Process

KEGG gene cross-reference

ath:AT2G47700

dosa:Os01g0350900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.707

Rank 1 · LXL04_038901 · OH-1004

Cytoplasm0.379

Rank 2 · LXL04_038901 · OH-1004

Cell membrane0.071

Rank 3 · LXL04_038901 · OH-1004

Endoplasmic reticulum0.053

Rank 4 · LXL04_038901 · OH-1004

Lysosome / Vacuole0.035

Rank 5 · LXL04_038901 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13639.13zf-RING_225-71 aa

PF17123.12zf-RING_1126-55 aa

PF00097.32zf-C3HC426-70 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_038901	`PF13639.13`	zf-RING_2	25	71	4.2e-08	34.0
LXL04_038901	`PF17123.12`	zf-RING_11	26	55	3.4e-07	30.6
LXL04_038901	`PF00097.32`	zf-C3HC4	26	70	2e-06	28.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O82239`	Arabidopsis thaliana	E3 ubiquitin-protein ligase RFI2	40.000%	Swiss-Prot	moderate database homology
`Q5Z8R1`	Oryza sativa subsp. japonica	E3 ubiquitin-protein ligase IPI1	56.173%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card