LXL04_038838 | RubberDandelionOmics

Gene overview

LXL04_038838

Reference: OH-1004 Chr: Chr09 Coordinates: 51660197-51666269 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2736 bp · LXL04_038838|LXL04_038838|OH1004|cDNA

ATGGAGGCGATTGAAGAACTGGCTCAACTTGCGGATTCGATGCGGCAGGCTGCGTCTCTGCTTAACGATGAAGATGTTGACGCAAACTCATCGTCTTCTTCAAAACGCCCTTCCACATTTCTCAACGTTGTTGCTCTTGGCAATACCAGTGCAGGTAAATCAGCAGTTTTGAACAGTTTGATTGGACATCCTGCTTTGCCAACTGGTGAAGGTGGTGCAACTCGCGCGCCTATATGCATTGACCTAAAGAGGGATGGTAA...

CDS

Download CDS FASTA

2736 bp · LXL04_038838|LXL04_038838|OH1004|CDS

ATGGAGGCGATTGAAGAACTGGCTCAACTTGCGGATTCGATGCGGCAGGCTGCGTCTCTGCTTAACGATGAAGATGTTGACGCAAACTCATCGTCTTCTTCAAAACGCCCTTCCACATTTCTCAACGTTGTTGCTCTTGGCAATACCAGTGCAGGTAAATCAGCAGTTTTGAACAGTTTGATTGGACATCCTGCTTTGCCAACTGGTGAAGGTGGTGCAACTCGCGCGCCTATATGCATTGACCTAAAGAGGGATGGTAA...

Protein

Download Protein FASTA

911 aa · LXL04_038838|LXL04_038838|OH1004|PROTEIN

MEAIEELAQLADSMRQAASLLNDEDVDANSSSSSKRPSTFLNVVALGNTSAGKSAVLNSLIGHPALPTGEGGATRAPICIDLKRDGNLSSKSIVLQIDSKSQPVSASSLRHSLQDRLSKVSSKSQSEIYLKLKTSTAPPLKLIDLPGVDKGNLDDSLSEYAQHNDAILLVIIPAAQAPEIASSKALKFAKEYDSESTRTIGVISKIDQASSDPKTLAAVKALLLGQGPRSSADIPWVALIGQSVSIASAQSGNVGPDNSL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_038838`
TK1151 ID	TkA04G470070
OH-1004 ID	LXL04_038838
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_038838

Location Chr09:51660197-51666269 (+)

Description Similar to DRP2B: Dynamin-2B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g59610`	Putative microtubule-associated force-producing protein, able to bind and hydrolyze GTP (By similarity).	Arabidopsis dynamin-related proteins DRP2B and DRP1A participate together in clathrin-coated vesicle formation during endocytosis.2010 · DOI: 10.1073/pnas.0913562107 Arabidopsis D6PK is a lipid domain-dependent mediator of root epidermal planar polarity.2015 · DOI: 10.1038/nplants.2015.162
`At1g10290`	Microtubule-associated force-producing protein involved in clathrin-mediated vesicle trafficking from the trans-Golgi network to the central vacuole.	A new dynamin-like protein, ADL6, is involved in trafficking from the trans-Golgi network to the central vacuole in Arabidopsis.2001 · DOI: 10.1105/tpc.000534 The intermolecular interaction between the PH domain and the C-terminal domain of Arabidopsis dynamin-like 6 determines lipid binding specificity.2002 · DOI: 10.1074/jbc.m204770200 Regulation of ADL6 activity by its associated molecular network.2002 · DOI: 10.1046/j.1365-313x.2002.01377.x
`At3g60190`	Microtubule-associated force-producing protein that is targeted to the tubulo-vesicular network of the forming cell plate during cytokinesis.	Members of the Arabidopsis dynamin-like gene family, ADL1, are essential for plant cytokinesis and polarized cell growth.2003 · DOI: 10.1105/tpc.009670 Phragmoplastin dynamics: multiple forms, microtubule association and their roles in cell plate formation in plants.2003 · DOI: 10.1023/b:plan.0000006936.50532.3a
`At2g44590`	Putative microtubule-associated force-producing protein.	No verified direct reference in this release
`At1g14830`	Microtubule-associated force-producing protein that is targeted to the growing edges of the cell plate during cytokinesis.	The dynamin-like protein ADL1C is essential for plasma membrane maintenance during pollen maturation.2003 · DOI: 10.1046/j.1365-313x.2003.01775.x Phragmoplastin dynamics: multiple forms, microtubule association and their roles in cell plate formation in plants.2003 · DOI: 10.1023/b:plan.0000006936.50532.3a Comparison of the dynamics and functional redundancy of the Arabidopsis dynamin-related isoforms DRP1A and DRP1C during plant development.2008 · DOI: 10.1104/pp.108.116863

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038838 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006896 Golgi to vacuole transport Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0048766 root hair initiation Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0051301 cell division Biological Process

GO:0072583 clathrin-dependent endocytosis Biological Process

GO:2000114 regulation of establishment of cell polarity Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0000325 plant-type vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT1G10290

ath:AT1G59610

ath:AT2G44590

ath:AT3G60190

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.493

Rank 1 · LXL04_038838 · OH-1004

Cell membrane0.332

Rank 2 · LXL04_038838 · OH-1004

Nucleus0.233

Rank 3 · LXL04_038838 · OH-1004

Golgi apparatus0.096

Rank 4 · LXL04_038838 · OH-1004

Endoplasmic reticulum0.082

Rank 5 · LXL04_038838 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00350.30Dynamin_N43-205 aa

PF01926.30MMR_HSR143-189 aa

PF01031.26Dynamin_M259-492 aa

PF15409.14PH_8569-625 aa

PF00169.36PH571-688 aa

PF02212.24GED725-807 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_038838	`PF00350.30`	Dynamin_N	43	205	1.4e-31	110.5
LXL04_038838	`PF01926.30`	MMR_HSR1	43	189	4.7e-07	30.6
LXL04_038838	`PF01031.26`	Dynamin_M	259	492	4.7e-23	82.5
LXL04_038838	`PF15409.14`	PH_8	569	625	3.3e-07	31.2
LXL04_038838	`PF00169.36`	PH	571	688	4e-12	47.3
LXL04_038838	`PF02212.24`	GED	725	807	1.2e-13	51.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LQ55`	Arabidopsis thaliana	Dynamin-2B	73.712%	Swiss-Prot	strong database homology
`Q9SE83`	Arabidopsis thaliana	Dynamin-2A	74.811%	Swiss-Prot	strong database homology
`Q9FNX5`	Arabidopsis thaliana	Phragmoplastin DRP1E	31.021%	Swiss-Prot	moderate database homology
`Q8S3C9`	Arabidopsis thaliana	Phragmoplastin DRP1D	29.709%	Swiss-Prot	weak database homology
`Q8LF21`	Arabidopsis thaliana	Phragmoplastin DRP1C	28.682%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card