LXL04_038760 | RubberDandelionOmics

Gene overview

LXL04_038760

Reference: OH-1004 Chr: Chr09 Coordinates: 49876467-49878912 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2121 bp · LXL04_038760|LXL04_038760|OH1004|cDNA

ATGGCTTCAACGGGGCCACAACAATCATCAGCGTCTCTGAAGAGGCGTGACTCGACGGTGACTAGAGAATCAGATTTACTGACCATTACTCCATTAGGCGCTGGAAGTGAAGTTGGAAGATCATGTGTATTCATGACTTTCAAAGGGAAAACTGTTATGTTCGATTGCGGGATTCATCCTGCGTTTTCGGGCATGGCTGCTTTGCCTTACTTTGACGAAATCGACCCTTCCACCATCGACGTTCTTCTCATTACTCATTT...

CDS

Download CDS FASTA

2121 bp · LXL04_038760|LXL04_038760|OH1004|CDS

ATGGCTTCAACGGGGCCACAACAATCATCAGCGTCTCTGAAGAGGCGTGACTCGACGGTGACTAGAGAATCAGATTTACTGACCATTACTCCATTAGGCGCTGGAAGTGAAGTTGGAAGATCATGTGTATTCATGACTTTCAAAGGGAAAACTGTTATGTTCGATTGCGGGATTCATCCTGCGTTTTCGGGCATGGCTGCTTTGCCTTACTTTGACGAAATCGACCCTTCCACCATCGACGTTCTTCTCATTACTCATTT...

Protein

Download Protein FASTA

706 aa · LXL04_038760|LXL04_038760|OH1004|PROTEIN

MASTGPQQSSASLKRRDSTVTRESDLLTITPLGAGSEVGRSCVFMTFKGKTVMFDCGIHPAFSGMAALPYFDEIDPSTIDVLLITHFHLDHAASLPYFLEKTTFKGRVFMTHATKAIYKLLLSDYVKVSKVSVEDMLFDEQDILRSMDKIEVIDFHQTLEVNGIRFWCYTAGHVLGAAMFMVDIAGVRVLYTGDYSREEDRHLRAAELPQFSPDICIIESTYGVQLHQSRHIREKRFTDVIHTTVSQGGRMLIPAFALGR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_038760`
TK1151 ID	TkA04G462690
OH-1004 ID	LXL04_038760
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_038760

Location Chr09:49876467-49878912 (+)

Description Similar to CPSF73-I: Cleavage and polyadenylation specificity factor subunit 3-I

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g61010`	Component of the cleavage and polyadenylation specificity factor (CPSF) complex that play a key role in pre-mRNA 3'-end formation, recognizing the AAUAAA signal sequence and interacting with poly(A) polymerase and other factors to bring about cleavage and poly(A) addition.	Unique features of plant cleavage and polyadenylation specificity factor revealed by proteomic studies.2009 · DOI: 10.1104/pp.109.142729

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038760 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006398 mRNA 3'-end processing by stem-loop binding and cleavage Biological Process

GO:0016180 snRNA processing Biological Process

GO:0031124 mRNA 3'-end processing Biological Process

GO:0071045 nuclear histone mRNA catabolic process Biological Process

GO:0180010 co-transcriptional mRNA 3'-end processing, cleavage and polyadenylation pathway Biological Process

GO:0180012 co-transcriptional RNA 3'-end processing, cleavage and polyadenylation pathway Biological Process

GO:1900087 positive regulation of G1/S transition of mitotic cell cycle Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005847 mRNA cleavage and polyadenylation specificity factor complex Cellular Component

GO:1990904 ribonucleoprotein complex Cellular Component

GO:0003723 RNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G61010

bta:281712

ddi:DDB_G0274799

hsa:51692

mmu:54451

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.798

Rank 1 · LXL04_038760 · OH-1004

Cytoplasm0.292

Rank 2 · LXL04_038760 · OH-1004

Mitochondrion0.043

Rank 3 · LXL04_038760 · OH-1004

Cell membrane0.024

Rank 4 · LXL04_038760 · OH-1004

Endoplasmic reticulum0.019

Rank 5 · LXL04_038760 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00753.34Lactamase_B39-201 aa

PF23023.2Anti-Pycsar_Apyc140-200 aa

PF16661.12Lactamase_B_645-209 aa

PF12706.14Lactamase_B_252-201 aa

PF10996.15Beta-Casp261-382 aa

PF07521.18RMMBL397-447 aa

PF11718.14CPSF73-100_C493-698 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_038760	`PF00753.34`	Lactamase_B	39	201	2e-19	71.0
LXL04_038760	`PF23023.2`	Anti-Pycsar_Apyc1	40	200	1.1e-08	35.8
LXL04_038760	`PF16661.12`	Lactamase_B_6	45	209	6.1e-18	65.6
LXL04_038760	`PF12706.14`	Lactamase_B_2	52	201	2.9e-06	27.7
LXL04_038760	`PF10996.15`	Beta-Casp	261	382	3e-30	106.0
LXL04_038760	`PF07521.18`	RMMBL	397	447	4.4e-13	49.7
LXL04_038760	`PF11718.14`	CPSF73-100_C	493	698	7.2e-47	160.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C952`	Arabidopsis thaliana	Cleavage and polyadenylation specificity factor subunit 3-I	78.398%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card