LXL04_038753 | RubberDandelionOmics

Gene overview

LXL04_038753

Reference: OH-1004 Chr: Chr09 Coordinates: 49758955-49762004 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1449 bp · LXL04_038753|LXL04_038753|OH1004|cDNA

ATGGCTACAAGAAAGCTGGTGCGAGATTTGTTTCTCTCTAAGCAGCCGCTTTATAGACAAAGTTTAGCTTACAAACAGGTTTGTACATCAGCATCGAGGTTAAGGTTACGTGGAGCCGCAAATGTGAACCCTACATATCGTGAATTCAGCGTGTTTAACGAGTTTTCGAAGAAGATTAAAGGCGAAGTGAACAGAAACCAGGACTTCCAACAAACGGTCAAAGAGTTGAAGGAGAAAACCGAAGAGCTCAAAGGAGTGAA...

CDS

Download CDS FASTA

1449 bp · LXL04_038753|LXL04_038753|OH1004|CDS

ATGGCTACAAGAAAGCTGGTGCGAGATTTGTTTCTCTCTAAGCAGCCGCTTTATAGACAAAGTTTAGCTTACAAACAGGTTTGTACATCAGCATCGAGGTTAAGGTTACGTGGAGCCGCAAATGTGAACCCTACATATCGTGAATTCAGCGTGTTTAACGAGTTTTCGAAGAAGATTAAAGGCGAAGTGAACAGAAACCAGGACTTCCAACAAACGGTCAAAGAGTTGAAGGAGAAAACCGAAGAGCTCAAAGGAGTGAA...

Protein

Download Protein FASTA

482 aa · LXL04_038753|LXL04_038753|OH1004|PROTEIN

MATRKLVRDLFLSKQPLYRQSLAYKQVCTSASRLRLRGAANVNPTYREFSVFNEFSKKIKGEVNRNQDFQQTVKELKEKTEELKGVKEDLKVRTKQTTEQLYKRVDGAWTEAEATAKKVSENLKEKVSAAKEEVKETLGIGKQESTESSSSSANEGSKDDKESGEKGDEKQEAGYGEAAGSIFSKVRSGVSSSFQKAKDAKVLDLAKKGYDIVKDELSGSPSKRKRAKAASAASSQANVETSSRTDVAVVPVKQSKFNKK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_038753`
TK1151 ID	TkA04G462540
OH-1004 ID	LXL04_038753
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_038753

Location Chr09:49758955-49762004 (-)

Description Similar to TIM44-2: Mitochondrial import inner membrane translocase subunit TIM44-2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g36070`	Essential component of the PAM complex, a complex required for the translocation of transit peptide-containing proteins from the inner membrane into the mitochondrial matrix in an ATP-dependent manner.	No verified direct reference in this release
`At2g20510`	Essential component of the PAM complex, a complex required for the translocation of transit peptide-containing proteins from the inner membrane into the mitochondrial matrix in an ATP-dependent manner.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038753 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006626 protein targeting to mitochondrion Biological Process

GO:0006886 intracellular protein transport Biological Process

GO:0030150 protein import into mitochondrial matrix Biological Process

GO:1905242 response to 3,3',5-triiodo-L-thyronine Biological Process

GO:0001650 fibrillar center Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0005744 TIM23 mitochondrial import inner membrane translocase complex Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0015462 ABC-type protein transporter activity Molecular Function

GO:0019899 enzyme binding Molecular Function

KEGG gene cross-reference

ath:AT2G20510

ath:AT2G36070

hsa:10469

mmu:21856

rno:29635

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.921

Rank 1 · LXL04_038753 · OH-1004

Cytoplasm0.081

Rank 2 · LXL04_038753 · OH-1004

Nucleus0.063

Rank 3 · LXL04_038753 · OH-1004

Cell membrane0.028

Rank 4 · LXL04_038753 · OH-1004

Endoplasmic reticulum0.016

Rank 5 · LXL04_038753 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04280.22Tim44324-475 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_038753	`PF04280.22`	Tim44	324	475	2.1e-36	126.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q5XF06`	Arabidopsis thaliana	Mitochondrial import inner membrane translocase subunit TIM44-2	57.054%	Swiss-Prot	strong database homology
`Q1PF33`	Arabidopsis thaliana	Mitochondrial import inner membrane translocase subunit TIM44-1	54.415%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card