LXL04_038524 | RubberDandelionOmics

Gene overview

LXL04_038524

Reference: OH-1004 Chr: Chr09 Coordinates: 43159656-43162682 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

957 bp · LXL04_038524|LXL04_038524|OH1004|cDNA

ATGTTAGAAGAGCTTGACTCTGGTGGAAATCAGCCTGATTTCGTGGTTGATTTGAACGTCATTAACTTCGATGCAGTTCTCAAGAACACCTCCGCTCCTTTCGCCGTTGTGGAGTTCTTCACTCACGGAAGCCGTTGCAGAGTGTATACGTCCCGGTATGGAAAGGTCGCTAGGCTTTTTAATGGAGTCGATGCTGTTCATCCAGGGATTATATTAGTGACAAGAGTAGACTGTGCCTATAAGTGGCTTATTGTTGCGGT...

CDS

Download CDS FASTA

957 bp · LXL04_038524|LXL04_038524|OH1004|CDS

ATGTTAGAAGAGCTTGACTCTGGTGGAAATCAGCCTGATTTCGTGGTTGATTTGAACGTCATTAACTTCGATGCAGTTCTCAAGAACACCTCCGCTCCTTTCGCCGTTGTGGAGTTCTTCACTCACGGAAGCCGTTGCAGAGTGTATACGTCCCGGTATGGAAAGGTCGCTAGGCTTTTTAATGGAGTCGATGCTGTTCATCCAGGGATTATATTAGTGACAAGAGTAGACTGTGCCTATAAGTGGCTTATTGTTGCGGT...

Protein

Download Protein FASTA

318 aa · LXL04_038524|LXL04_038524|OH1004|PROTEIN

MLEELDSGGNQPDFVVDLNVINFDAVLKNTSAPFAVVEFFTHGSRCRVYTSRYGKVARLFNGVDAVHPGIILVTRVDCAYKWLIVAVESAGRTLPMGFLERVKDEFNKKYGGGKASTAAAKSLSKSFGPKMKDEMSYCVAHPEEIDKIAKVKAQVDEVKGVMMDNIEKKRLNCWWIIDGNFEARVSDFGLAKLLEDEESHITTIVAGTFGYLAPEYMQSGRATEKTDVYSFGVLMLEVLSRKRPTDASFIEKGLNIVGWL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_038524`
TK1151 ID	TkA04G438740
OH-1004 ID	LXL04_038524
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_038524

Location Chr09:43159656-43162682 (-)

Description Similar to FEI1: LRR receptor-like serine/threonine-protein kinase FEI 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g31420`	Involved in the signaling pathway that regulates cell wall function, including cellulose biosynthesis, likely via an 1- aminocyclopropane-1-carboxylic acid (ACC)-mediated signal (a precursor of ethylene).	Two leucine-rich repeat receptor kinases mediate signaling, linking cell wall biosynthesis and ACC synthase in Arabidopsis.2008 · DOI: 10.1105/tpc.108.063354
`At2g35620`	Involved in the signaling pathway that regulates cell wall function, including cellulose biosynthesis, likely via an 1- aminocyclopropane-1-carboxylic acid (ACC)-mediated signal (a precursor of ethylene).	Two leucine-rich repeat receptor kinases mediate signaling, linking cell wall biosynthesis and ACC synthase in Arabidopsis.2008 · DOI: 10.1105/tpc.108.063354
`At1g04760`	Involved in the targeting and/or fusion of transport vesicles to their target membrane.	No verified direct reference in this release
`At2g33120`	Involved in the targeting and/or fusion of transport vesicles to their target membrane.	No verified direct reference in this release
`At1g04750`	Involved in the targeting and/or fusion of transport vesicles to their target membrane.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038524 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000045 autophagosome assembly Biological Process

GO:0009664 plant-type cell wall organization Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0009832 plant-type cell wall biogenesis Biological Process

GO:0009920 cell plate formation involved in plant-type cell wall biogenesis Biological Process

GO:0010192 mucilage biosynthetic process Biological Process

GO:0015031 protein transport Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0034976 response to endoplasmic reticulum stress Biological Process

GO:0048354 mucilage biosynthetic process involved in seed coat development Biological Process

GO:0072659 protein localization to plasma membrane Biological Process

GO:0000325 plant-type vacuole Cellular Component

KEGG gene cross-reference

ath:AT1G04750

ath:AT1G04760

ath:AT1G31420

ath:AT2G33120

ath:AT2G35620

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.394

Rank 1 · LXL04_038524 · OH-1004

Cell membrane0.320

Rank 2 · LXL04_038524 · OH-1004

Nucleus0.278

Rank 3 · LXL04_038524 · OH-1004

Endoplasmic reticulum0.093

Rank 4 · LXL04_038524 · OH-1004

Golgi apparatus0.050

Rank 5 · LXL04_038524 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13774.14Longin83-130 aa

PF00069.32Pkinase178-246 aa

PF07714.24PK_Tyr_Ser-Thr178-241 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_038524	`PF13774.14`	Longin	83	130	5.7e-08	33.5
LXL04_038524	`PF00069.32`	Pkinase	178	246	2.9e-13	50.5
LXL04_038524	`PF07714.24`	PK_Tyr_Ser-Thr	178	241	3.6e-12	46.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`C0LGF4`	Arabidopsis thaliana	LRR receptor-like serine/threonine-protein kinase FEI 1	78.992%	Swiss-Prot	weak database homology
`C0LGL9`	Arabidopsis thaliana	LRR receptor-like serine/threonine-protein kinase FEI 2	79.832%	Swiss-Prot	weak database homology
`Q9MAS5`	Arabidopsis thaliana	Putative vesicle-associated membrane protein 726	66.304%	Swiss-Prot	weak database homology
`P47192`	Arabidopsis thaliana	Vesicle-associated membrane protein 722	65.591%	Swiss-Prot	weak database homology
`Q9ZTW3`	Arabidopsis thaliana	Vesicle-associated membrane protein 721	65.591%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card