LXL04_038500 | RubberDandelionOmics

Gene overview

LXL04_038500

Reference: OH-1004 Chr: Chr09 Coordinates: 42519467-42523621 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1830 bp · LXL04_038500|LXL04_038500|OH1004|cDNA

atgtcggactcggtccgtggtccgaggcgtttgataggcgagtttgatgtcggactcggtccgtggtccgtggtccatgCGTTCATGGCGAAATCGGAACAAgcgtcttcatcatcttcgACGGTAGATTCTTCATCGCGGCCATGGGAGTCTTATCACACTGTTTATACTAATGCCAAAGCAGGTATGGATGGAGTTGATAAGGAAAAAGTACAAAGAGTAGTATATGAAATGAGCAAAGGTTCAAAGTATTTCGAGAA...

CDS

Download CDS FASTA

1830 bp · LXL04_038500|LXL04_038500|OH1004|CDS

ATGTCGGACTCGGTCCGTGGTCCGAGGCGTTTGATAGGCGAGTTTGATGTCGGACTCGGTCCGTGGTCCGTGGTCCATGCGTTCATGGCGAAATCGGAACAAGCGTCTTCATCATCTTCGACGGTAGATTCTTCATCGCGGCCATGGGAGTCTTATCACACTGTTTATACTAATGCCAAAGCAGGTATGGATGGAGTTGATAAGGAAAAAGTACAAAGAGTAGTATATGAAATGAGCAAAGGTTCAAAGTATTTCGAGAA...

Protein

Download Protein FASTA

609 aa · LXL04_038500|LXL04_038500|OH1004|PROTEIN

MSDSVRGPRRLIGEFDVGLGPWSVVHAFMAKSEQASSSSSTVDSSSRPWESYHTVYTNAKAGMDGVDKEKVQRVVYEMSKGSKYFENEERKEAYMKQKIDNMRDLREKLKAPDISHYQRVADKRIAQLEATRDLSKIWLHVDMDAFYAAVETLSNPSLKGRPMAVGSMSMISTANYEARKFGVRAAMPGFIACKLCPDLIFVPTDFKKYTYYSDLTRKVYHEYDPNFTAASLDEAYLDITKVCKERDLTGEKVAEELREN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_038500`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_038500

Location Chr09:42519467-42523621 (-)

Description Similar to POLK: DNA polymerase kappa

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g49980`	Template-directed low-fidelity DNA polymerase specifically involved in DNA repair.	Arabidopsis thaliana AtPOLK encodes a DinB-like DNA polymerase that extends mispaired primer termini and is highly expressed in a variety of tissues.2004 · DOI: 10.1111/j.1365-313x.2004.02112.x The noncatalytic C-terminus of AtPOLK Y-family DNA polymerase affects synthesis fidelity, mismatch extension and translesion replication.2007 · DOI: 10.1111/j.1742-4658.2007.05868.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038500 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000731 DNA synthesis involved in DNA repair Biological Process

GO:0006261 DNA-templated DNA replication Biological Process

GO:0006281 DNA repair Biological Process

GO:0006974 DNA damage response Biological Process

GO:0009432 SOS response Biological Process

GO:0019985 translesion synthesis Biological Process

GO:0042276 error-prone translesion synthesis Biological Process

GO:0051321 meiotic cell cycle Biological Process

GO:0070987 error-free translesion synthesis Biological Process

GO:0000785 chromatin Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT1G49980

cel:CELE_F22B7.6

spo:2539547

tte:TTE0254

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.913

Rank 1 · LXL04_038500 · OH-1004

Cytoplasm0.169

Rank 2 · LXL04_038500 · OH-1004

Mitochondrion0.051

Rank 3 · LXL04_038500 · OH-1004

Cell membrane0.016

Rank 4 · LXL04_038500 · OH-1004

Golgi apparatus0.007

Rank 5 · LXL04_038500 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00817.26IMS141-285 aa

PF11799.14IMS_C366-468 aa

PF18439.8zf_UBZ527-561 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_038500	`PF00817.26`	IMS	141	285	3.8e-48	163.9
LXL04_038500	`PF11799.14`	IMS_C	366	468	1.5e-19	71.1
LXL04_038500	`PF18439.8`	zf_UBZ	527	561	4.2e-08	33.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6JDV7`	Arabidopsis thaliana	DNA polymerase kappa	70.122%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card