LXL04_038280 | RubberDandelionOmics

Gene overview

LXL04_038280

Reference: OH-1004 Chr: Chr09 Coordinates: 36368315-36369283 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

888 bp · LXL04_038280|LXL04_038280|OH1004|cDNA

ATGGCTTTTGGATTTGCATCTTGGGTCCTCttctttcatcttcttctttctcCGCATGCTAAAGGAGATAGAGCTACAGAATCTAATGTCTTAAGACTCAATACAATTGACGATGCCACTAATGATGTCCATCATCATGATCATATGCATCAAGATCATGGTCATGATAAATCATCGTTATCATCACAAACGAACAAAAAAGACCCTCGATTAATGGTTTTCTTCATGATAAATGACCTCAAAGTAGGCCATGTGATGCA...

CDS

Download CDS FASTA

888 bp · LXL04_038280|LXL04_038280|OH1004|CDS

ATGGCTTTTGGATTTGCATCTTGGGTCCTCTTCTTTCATCTTCTTCTTTCTCCGCATGCTAAAGGAGATAGAGCTACAGAATCTAATGTCTTAAGACTCAATACAATTGACGATGCCACTAATGATGTCCATCATCATGATCATATGCATCAAGATCATGGTCATGATAAATCATCGTTATCATCACAAACGAACAAAAAAGACCCTCGATTAATGGTTTTCTTCATGATAAATGACCTCAAAGTAGGCCATGTGATGCA...

Protein

Download Protein FASTA

295 aa · LXL04_038280|LXL04_038280|OH1004|PROTEIN

MAFGFASWVLFFHLLLSPHAKGDRATESNVLRLNTIDDATNDVHHHDHMHQDHGHDKSSLSSQTNKKDPRLMVFFMINDLKVGHVMQIYFPNRHLSPSQLISKQEADSIPFSLEELPNLLQFFSISQGSPKAIAMESTLKECEVKPIKGETKFCATSLESMQEFTRKIFGSDTQVKTLTTTHLKKRTIGLLQNYKIVEISQNIPSPKLVACHTMPYPYSVFYCHSQESENKVLMVSLEGEDGDLVEALSVCHMDTSQWSP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_038280`
TK1151 ID	TkA04G413610
OH-1004 ID	LXL04_038280
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	83.900
Protein coverage (%)	TK1151 30.097 / OH-1004 10.508 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_038280

Location Chr09:36368315-36369283 (+)

Description Similar to BNM2A: BURP domain-containing protein BNM2A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g49320`	Associated with the protein storage vacuole formation.	The BURP domain protein AtUSPL1 of Arabidopsis thaliana is destined to the protein storage vacuoles and overexpression of the cognate gene distorts seed development.2009 · DOI: 10.1007/s11103-009-9526-6

Rice

Reference gene ID	Possible function	Papers / DOI
`Os11g0170900`	BURP domain-containing protein 17.	No verified direct reference in this release
`Os01g0733500`	BURP domain-containing protein 3.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038280 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0048316 seed development Biological Process

GO:0000326 protein storage vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005795 Golgi stack Cellular Component

KEGG gene cross-reference

ath:AT1G49320

bna:106419576

bna:106439079

dosa:Os01g0733500

dosa:Os11g0170900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.413

Rank 1 · LXL04_038280 · OH-1004

Extracellular0.263

Rank 2 · LXL04_038280 · OH-1004

Endoplasmic reticulum0.211

Rank 3 · LXL04_038280 · OH-1004

Cytoplasm0.161

Rank 4 · LXL04_038280 · OH-1004

Golgi apparatus0.100

Rank 5 · LXL04_038280 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03181.21BURP73-289 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_038280	`PF03181.21`	BURP	73	289	3e-77	259.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XI99`	Arabidopsis thaliana	BURP domain protein USPL1	41.057%	Swiss-Prot	moderate database homology
`B9G9L9`	Oryza sativa subsp. japonica	BURP domain-containing protein 17	39.608%	Swiss-Prot	moderate database homology
`Q942D4`	Oryza sativa subsp. japonica	BURP domain-containing protein 3	40.179%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card