LXL04_038274 | RubberDandelionOmics

Gene overview

LXL04_038274

Reference: OH-1004 Chr: Chr09 Coordinates: 36211457-36216910 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2682 bp · LXL04_038274|LXL04_038274|OH1004|cDNA

ATGGCGCAGTTTGTGAAGAAAGACGATGATCGCGATGAGGAAGCAGAGTACTCTCCCTTTCTTGGAATCGAGAAGGGAGCAGTTCTTCAAGAAGCTAGGGTCTTCAATGATCCTCAGCTAGATTCAAGGAGGTGTTCACAGGTCATTACAAAGCTGCTTTACCTTCTAAACCAAGGGGAAACCTTCACAAAGGTTGAAGCCACAGAAGTTTTCTTTTCTGTGACAAAACTTTTCCAGTCTAAAGACATTGGTTTAAGAAG...

CDS

Download CDS FASTA

2682 bp · LXL04_038274|LXL04_038274|OH1004|CDS

ATGGCGCAGTTTGTGAAGAAAGACGATGATCGCGATGAGGAAGCAGAGTACTCTCCCTTTCTTGGAATCGAGAAGGGAGCAGTTCTTCAAGAAGCTAGGGTCTTCAATGATCCTCAGCTAGATTCAAGGAGGTGTTCACAGGTCATTACAAAGCTGCTTTACCTTCTAAACCAAGGGGAAACCTTCACAAAGGTTGAAGCCACAGAAGTTTTCTTTTCTGTGACAAAACTTTTCCAGTCTAAAGACATTGGTTTAAGAAG...

Protein

Download Protein FASTA

893 aa · LXL04_038274|LXL04_038274|OH1004|PROTEIN

MAQFVKKDDDRDEEAEYSPFLGIEKGAVLQEARVFNDPQLDSRRCSQVITKLLYLLNQGETFTKVEATEVFFSVTKLFQSKDIGLRRMVYLIIKELSPSSDELHIPVHKKVIIVTSSLMKDMNSKTDVYRANAIRVLCRITDGTLLTQIERYLKQAIVDKNPVVASAALVSGIHLLQTNPEIVKRWSNEVQEAVQSRAALVQFHALALLHQIRQNDRLAVSKLVTSLTRGTVRSPLAQCLLIRYTSQVIRESSMNIQGGE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_038274`
TK1151 ID	TkA04G413070
OH-1004 ID	LXL04_038274
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_038274

Location Chr09:36211457-36216910 (-)

Description Similar to Os07g0201100: Coatomer subunit gamma-2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g34450`	The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0201100`	The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network.	No verified direct reference in this release
`Os03g0227000`	The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038274 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006886 intracellular protein transport Biological Process

GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process

GO:0006891 intra-Golgi vesicle-mediated transport Biological Process

GO:0009306 protein secretion Biological Process

GO:0072384 organelle transport along microtubule Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005793 endoplasmic reticulum-Golgi intermediate compartment Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

KEGG gene cross-reference

ath:AT4G34450

bta:536616

dosa:Os03g0227000

dosa:Os07g0201100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.528

Rank 1 · LXL04_038274 · OH-1004

Golgi apparatus0.349

Rank 2 · LXL04_038274 · OH-1004

Nucleus0.198

Rank 3 · LXL04_038274 · OH-1004

Lysosome / Vacuole0.118

Rank 4 · LXL04_038274 · OH-1004

Endoplasmic reticulum0.117

Rank 5 · LXL04_038274 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01602.27Adaptin_N26-547 aa

PF12717.14Cnd1130-225 aa

PF08752.17COP-gamma_platf629-774 aa

PF16381.11Coatomer_g_Cpla777-891 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_038274	`PF01602.27`	Adaptin_N	26	547	4.7e-141	471.6
LXL04_038274	`PF12717.14`	Cnd1	130	225	1.4e-13	52.0
LXL04_038274	`PF08752.17`	COP-gamma_platf	629	774	7.1e-55	186.0
LXL04_038274	`PF16381.11`	Coatomer_g_Cpla	777	891	1.7e-37	128.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WW26`	Arabidopsis thaliana	Coatomer subunit gamma	83.221%	Swiss-Prot	strong database homology
`Q6Z382`	Oryza sativa subsp. japonica	Coatomer subunit gamma-2	83.929%	Swiss-Prot	strong database homology
`Q8H852`	Oryza sativa subsp. japonica	Coatomer subunit gamma-1	80.291%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card