LXL04_038071 | RubberDandelionOmics

Gene overview

LXL04_038071

Reference: OH-1004 Chr: Chr09 Coordinates: 30723439-30726376 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1686 bp · LXL04_038071|LXL04_038071|OH1004|cDNA

ATGATTTCTACGCCGTTCATTGCTATACATGCGTCTCTCTTCCGGGATTTGGTTAATAAAGATACATGCGAACCAAAAATGGAGCGCGAAAGAAGTACCAATGAAATATCGGTTACATGGAGGGGGAAGAAGTATGTCGTGACCATGAATTTAGCTGCCACTCTCGAAGAATTAGGGCACGAATTACAGAAACTAACTGCAGTGAAATCAGATACTTTGAAGCTCATTGTCCAATTCCATAAATCATCGAAACTCTTCTC...

CDS

Download CDS FASTA

1686 bp · LXL04_038071|LXL04_038071|OH1004|CDS

ATGATTTCTACGCCGTTCATTGCTATACATGCGTCTCTCTTCCGGGATTTGGTTAATAAAGATACATGCGAACCAAAAATGGAGCGCGAAAGAAGTACCAATGAAATATCGGTTACATGGAGGGGGAAGAAGTATGTCGTGACCATGAATTTAGCTGCCACTCTCGAAGAATTAGGGCACGAATTACAGAAACTAACTGCAGTGAAATCAGATACTTTGAAGCTCATTGTCCAATTCCATAAATCATCGAAACTCTTCTC...

Protein

Download Protein FASTA

561 aa · LXL04_038071|LXL04_038071|OH1004|PROTEIN

MISTPFIAIHASLFRDLVNKDTCEPKMERERSTNEISVTWRGKKYVVTMNLAATLEELGHELQKLTAVKSDTLKLIVQFHKSSKLFSPFSDEHSYLTLQETSILEGKPIRMMGVPKEEIDQVLESSRTDMRIPGFDEEEKRMRQRMSNGFDTPLKLPQGNYVFGGFKTLDLPGIQLNPPPSEALRLMHTLAADRGIVAVMNKHKWRVGIMTEMAPEGYVGVSPVCILGLNKNKGEEISLRLRTDDLKGFRKYQSIKMTLL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_038071`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_038071`
Location	Chr09:30723439-30726376 (-)
Description	Similar to SPCC1442.07c: Ubiquitin and WLM domain-containing metalloprotease SPCC1442.07c (Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_038071` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006281 DNA repair Biological Process GO:0006508 proteolysis Biological Process GO:0016925 protein sumoylation Biological Process GO:0005634 nucleus Cellular Component GO:0005829 cytosol Cellular Component GO:0003690 double-stranded DNA binding Molecular Function GO:0003697 single-stranded DNA binding Molecular Function GO:0008237 metallopeptidase activity Molecular Function GO:0008270 zinc ion binding Molecular Function GO:0046914 transition metal ion binding Molecular Function GO:0070628 proteasome binding Molecular Function
KEGG gene cross-reference	spo:2538751 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.553

Rank 1 · LXL04_038071 · OH-1004

Nucleus0.453

Rank 2 · LXL04_038071 · OH-1004

Cell membrane0.071

Rank 3 · LXL04_038071 · OH-1004

Endoplasmic reticulum0.065

Rank 4 · LXL04_038071 · OH-1004

Golgi apparatus0.059

Rank 5 · LXL04_038071 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08325.17WLM174-345 aa

PF09409.16PUB472-546 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_038071	`PF08325.17`	WLM	174	345	1e-44	153.6
LXL04_038071	`PF09409.16`	PUB	472	546	1.8e-17	63.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card