LXL04_037958 | RubberDandelionOmics

Gene overview

LXL04_037958

Reference: OH-1004 Chr: Chr09 Coordinates: 26847384-26849365 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1122 bp · LXL04_037958|LXL04_037958|OH1004|cDNA

ATGGGATCTAAGCGATCTGACTTCGGCGACGGCGCCAGTCCCGGGAAGATATTTATCGGAGGCTTAGCGAGAGATACTAGTATAGATGCTTTTGTTAAGTACTTTGGCAAGTATGGAGAGATTACGGACTCGGTTATTATGAAAGATCGACAAACTGGTCGGCCGAGAGGTTTTGGATTTATCACATATGCAGATCCTTCTGTTGTTGACACTGTAATTGCTGAGACACATGTCATAAATGGAAAACAGGTTGAGATCAA...

CDS

Download CDS FASTA

1122 bp · LXL04_037958|LXL04_037958|OH1004|CDS

ATGGGATCTAAGCGATCTGACTTCGGCGACGGCGCCAGTCCCGGGAAGATATTTATCGGAGGCTTAGCGAGAGATACTAGTATAGATGCTTTTGTTAAGTACTTTGGCAAGTATGGAGAGATTACGGACTCGGTTATTATGAAAGATCGACAAACTGGTCGGCCGAGAGGTTTTGGATTTATCACATATGCAGATCCTTCTGTTGTTGACACTGTAATTGCTGAGACACATGTCATAAATGGAAAACAGGTTGAGATCAA...

Protein

Download Protein FASTA

373 aa · LXL04_037958|LXL04_037958|OH1004|PROTEIN

MGSKRSDFGDGASPGKIFIGGLARDTSIDAFVKYFGKYGEITDSVIMKDRQTGRPRGFGFITYADPSVVDTVIAETHVINGKQVEIKRTIPKGSGESRDYKTKKIFVGGIPTSVTEDELKDFFSKHGTIVEHEIIRDHVTKRSRGFGFIVFDSEQTVDEILVNGNMIDMNGTQVEIKKAEPKKPSNPAPHSYNREPKGRGYTDSFDAYDDPYGGGYGGIGGGGGGGGGYGPPSYRSFSGIPSRYGDYGPYGPGASEFANR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_037958`
TK1151 ID	TkA04G367830
OH-1004 ID	LXL04_037958
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_037958

Location Chr09:26847384-26849365 (+)

Description Similar to RNP1: Heterogeneous nuclear ribonucleoprotein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g14300`	Involved with pre-mRNA processing.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037958 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0007283 spermatogenesis Biological Process

GO:0007319 negative regulation of oskar mRNA translation Biological Process

GO:0008283 cell population proliferation Biological Process

GO:0008380 RNA splicing Biological Process

GO:0010228 vegetative to reproductive phase transition of meristem Biological Process

GO:0030154 cell differentiation Biological Process

GO:0045727 positive regulation of translation Biological Process

GO:0048024 regulation of mRNA splicing, via spliceosome Biological Process

GO:0048026 positive regulation of mRNA splicing, via spliceosome Biological Process

GO:0051028 mRNA transport Biological Process

GO:1901000 regulation of response to salt stress Biological Process

KEGG gene cross-reference

ath:AT4G14300

dme:Dmel_CG10377

hsa:26528

mmu:70248

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.839

Rank 1 · LXL04_037958 · OH-1004

Cytoplasm0.379

Rank 2 · LXL04_037958 · OH-1004

Cell membrane0.033

Rank 3 · LXL04_037958 · OH-1004

Endoplasmic reticulum0.027

Rank 4 · LXL04_037958 · OH-1004

Mitochondrion0.022

Rank 5 · LXL04_037958 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00076.29RRM_117-75 aa

PF23085.2RRM_PARP14_318-87 aa

PF16367.12RRM_7103-165 aa

PF00076.29RRM_1105-173 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_037958	`PF00076.29`	RRM_1	17	75	1.5e-32	112.0
LXL04_037958	`PF23085.2`	RRM_PARP14_3	18	87	3.6e-08	34.1
LXL04_037958	`PF16367.12`	RRM_7	103	165	9.3e-15	55.1
LXL04_037958	`PF00076.29`	RRM_1	105	173	1.5e-32	112.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8W034`	Arabidopsis thaliana	Heterogeneous nuclear ribonucleoprotein 1	40.741%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card