LXL04_037649 | RubberDandelionOmics

Gene overview

LXL04_037649

Reference: OH-1004 Chr: Chr09 Coordinates: 17088221-17092369 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2511 bp · LXL04_037649|LXL04_037649|OH1004|cDNA

ATGATAATGGAGAACTCGTCGGAATCCGGTTGTCAGAGGTCCGGCAGCTCGCGGGGGTTGAATTCTTCAGGCGTTTCAAACCGAATTCCTAGAATAACCCCTACAGGAGCTTTCAGATTCTCAGGCGACACAGATCATGATTCCGGAATCATACCAGGAActagaagaagaagagaaaaaTCCGTTTTACCTCAATCTAACCGCCTCGGAGCTCACTTCGGTTACTTCAGGGAAGACGAcggcaccggcaccggcaccgT...

CDS

Download CDS FASTA

2511 bp · LXL04_037649|LXL04_037649|OH1004|CDS

ATGATAATGGAGAACTCGTCGGAATCCGGTTGTCAGAGGTCCGGCAGCTCGCGGGGGTTGAATTCTTCAGGCGTTTCAAACCGAATTCCTAGAATAACCCCTACAGGAGCTTTCAGATTCTCAGGCGACACAGATCATGATTCCGGAATCATACCAGGAACTAGAAGAAGAAGAGAAAAATCCGTTTTACCTCAATCTAACCGCCTCGGAGCTCACTTCGGTTACTTCAGGGAAGACGACGGCACCGGCACCGGCACCGT...

Protein

Download Protein FASTA

836 aa · LXL04_037649|LXL04_037649|OH1004|PROTEIN

MIMENSSESGCQRSGSSRGLNSSGVSNRIPRITPTGAFRFSGDTDHDSGIIPGTRRRREKSVLPQSNRLGAHFGYFREDDGTGTGTVIRPVEAKDVSLRQWLDNTERVVDALECLHIFMQIVEIVNLAHSQGFVVHNVRPSCFVMSSFNRVSFIESVSCSDSGSDSCDDVSNNNNQTADFMGLCSSSGPDRGNQTQTQTQTSWLQSGSENLNTSNVDQAEDKKNRFPMKQILQMESNWYTSPEEAAGGHSSSASDVYRLG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_037649`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_037649

Location Chr09:17088221-17092369 (+)

Description Similar to SPA3: Protein SPA1-RELATED 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g15354`	Repressor of photomorphogenesis in the light.	The SPA1-like proteins SPA3 and SPA4 repress photomorphogenesis in the light.2003 · DOI: 10.1046/j.1365-313x.2003.01813.x Functional and expression analysis of Arabidopsis SPA genes during seedling photomorphogenesis and adult growth.2006 · DOI: 10.1111/j.1365-313x.2006.02812.x Arabidopsis SPA proteins regulate photoperiodic flowering and interact with the floral inducer CONSTANS to regulate its stability.2006 · DOI: 10.1242/dev.02481
`At1g53090`	Repressor of photomorphogenesis in the light.	The SPA1-like proteins SPA3 and SPA4 repress photomorphogenesis in the light.2003 · DOI: 10.1046/j.1365-313x.2003.01813.x Functional and expression analysis of Arabidopsis SPA genes during seedling photomorphogenesis and adult growth.2006 · DOI: 10.1111/j.1365-313x.2006.02812.x Arabidopsis SPA proteins regulate photoperiodic flowering and interact with the floral inducer CONSTANS to regulate its stability.2006 · DOI: 10.1242/dev.02481
`At4g11110`	Involved in suppression of photomorphogenesis in dark-grown seedlings.	The SPA quartet: a family of WD-repeat proteins with a central role in suppression of photomorphogenesis in arabidopsis.2004 · DOI: 10.1105/tpc.104.024216 Functional and expression analysis of Arabidopsis SPA genes during seedling photomorphogenesis and adult growth.2006 · DOI: 10.1111/j.1365-313x.2006.02812.x
`UniProt: Q9SYX2`	Controls normal photoperiodic flowering and regulates circadian rhythms.	No verified direct reference in this release
`At2g32950`	E3 ubiquitin-protein ligase that acts as a repressor of photomorphogenesis and as an activator of etiolation in darkness.	Two interacting bZIP proteins are direct targets of COP1-mediated control of light-dependent gene expression in Arabidopsis.2002 · DOI: 10.1101/gad.969702 Short Hypocotyl in White Light1 Interacts with Elongated Hypocotyl5 (HY5) and Constitutive Photomorphogenic1 (COP1) and Promotes COP1-Mediated Degradation of HY5 during Arabidopsis Seedling Development.2015 · DOI: 10.1104/pp.15.01184 PHYTOCHROME INTERACTING FACTOR8 Inhibits Phytochrome A-Mediated Far-Red Light Responses in Arabidopsis.2020 · DOI: 10.1105/tpc.19.00515 Role of a COP1 interactive protein in mediating light-regulated gene expression in arabidopsis.1998 · DOI: 10.1105/tpc.10.7.1083

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037649 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006281 DNA repair Biological Process

GO:0009585 red, far-red light phototransduction Biological Process

GO:0009637 response to blue light Biological Process

GO:0009640 photomorphogenesis Biological Process

GO:0009641 shade avoidance Biological Process

GO:0009647 skotomorphogenesis Biological Process

GO:0009649 entrainment of circadian clock Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0009963 positive regulation of flavonoid biosynthetic process Biological Process

GO:0010017 red or far-red light signaling pathway Biological Process

GO:0010100 negative regulation of photomorphogenesis Biological Process

GO:0010114 response to red light Biological Process

KEGG gene cross-reference

ath:AT1G53090

ath:AT2G32950

ath:AT2G46340

ath:AT3G15354

ath:AT4G11110

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.637

Rank 1 · LXL04_037649 · OH-1004

Cytoplasm0.323

Rank 2 · LXL04_037649 · OH-1004

Cell membrane0.072

Rank 3 · LXL04_037649 · OH-1004

Lysosome / Vacuole0.050

Rank 4 · LXL04_037649 · OH-1004

Golgi apparatus0.038

Rank 5 · LXL04_037649 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25173.2Beta-prop_WDR3_1st524-662 aa

PF23389.2Beta-prop_WDR19_1st524-668 aa

PF25175.2Beta-prop_WDR5526-780 aa

PF25174.2Beta-prop_THOC3527-606 aa

PF24796.2WDR55527-658 aa

PF25391.2WD40_Gbeta528-692 aa

PF23775.2Beta-prop_RIG_2nd539-609 aa

PF29037.1DSE1_N574-653 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_037649	`PF25173.2`	Beta-prop_WDR3_1st	524	662	4.4e-33	115.3
LXL04_037649	`PF23389.2`	Beta-prop_WDR19_1st	524	668	1.6e-08	34.7
LXL04_037649	`PF25175.2`	Beta-prop_WDR5	526	780	4.7e-34	118.7
LXL04_037649	`PF25174.2`	Beta-prop_THOC3	527	606	4.8e-31	108.5
LXL04_037649	`PF24796.2`	WDR55	527	658	2.8e-14	53.6
LXL04_037649	`PF25391.2`	WD40_Gbeta	528	692	7.3e-11	42.4
LXL04_037649	`PF23775.2`	Beta-prop_RIG_2nd	539	609	3.2e-12	47.2
LXL04_037649	`PF29037.1`	DSE1_N	574	653	1.6e-13	51.2
LXL04_037649	`PF24807.2`	WD40_CDC20-Fz	575	668	2.6e-29	103.2
LXL04_037649	`PF23609.2`	Beta-prop_EIPR1	575	646	7.7e-13	49.2
LXL04_037649	`PF25174.2`	Beta-prop_THOC3	576	775	4.8e-31	108.5
LXL04_037649	`PF23419.3`	WD40_RFWD3	578	666	2.5e-08	34.4
LXL04_037649	`PF23381.2`	Beta-prop_IFT122_1st	580	668	1.6e-27	97.3
LXL04_037649	`PF24817.2`	WD40_WDHD1_1st	589	659	6.8e-23	82.0
LXL04_037649	`PF23414.2`	Beta-prop_EML_2	589	738	3.9e-19	69.8
LXL04_037649	`PF24105.2`	Beta-prop_CAF1B_HIR1	589	653	2.6e-09	37.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LJR3`	Arabidopsis thaliana	Protein SPA1-RELATED 3	59.565%	Swiss-Prot	strong database homology
`Q94BM7`	Arabidopsis thaliana	Protein SPA1-RELATED 4	61.832%	Swiss-Prot	strong database homology
`Q9T014`	Arabidopsis thaliana	Protein SPA1-RELATED 2	41.146%	Swiss-Prot	moderate database homology
`Q9SYX2`	Arabidopsis thaliana	Protein SUPPRESSOR OF PHYA-105 1	40.684%	Swiss-Prot	moderate database homology
`P43254`	Arabidopsis thaliana	E3 ubiquitin-protein ligase COP1	39.091%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card