LXL04_037603 | RubberDandelionOmics

Gene overview

LXL04_037603

Reference: OH-1004 Chr: Chr09 Coordinates: 15699706-15702870 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1269 bp · LXL04_037603|LXL04_037603|OH1004|cDNA

ATGGCCATGGCGATGCGTATTTCTTCCCAATCCTTATTTTCTGTAATCAATTCTGAATTCTTCCTCCTTCTCCTTTGCTATGATTCAGTTCTAGTTTCACCTTCTTTTGAATTTTACTGTGAAAACCCTCGTTTAATATATTTTGGGGATGAGCTGAACTATAAGTTAAAAAGCAAAACAGATGTTGTTCATCATCCAGCTAGCAAATATTATAAATTTAATGGTATTTATAAAACCACAAGAATATCATTTGGAGGGTC...

CDS

Download CDS FASTA

1269 bp · LXL04_037603|LXL04_037603|OH1004|CDS

ATGGCCATGGCGATGCGTATTTCTTCCCAATCCTTATTTTCTGTAATCAATTCTGAATTCTTCCTCCTTCTCCTTTGCTATGATTCAGTTCTAGTTTCACCTTCTTTTGAATTTTACTGTGAAAACCCTCGTTTAATATATTTTGGGGATGAGCTGAACTATAAGTTAAAAAGCAAAACAGATGTTGTTCATCATCCAGCTAGCAAATATTATAAATTTAATGGTATTTATAAAACCACAAGAATATCATTTGGAGGGTC...

Protein

Download Protein FASTA

422 aa · LXL04_037603|LXL04_037603|OH1004|PROTEIN

MAMAMRISSQSLFSVINSEFFLLLLCYDSVLVSPSFEFYCENPRLIYFGDELNYKLKSKTDVVHHPASKYYKFNGIYKTTRISFGGSVKNVQTVCRITVPGPTLETVVNPPSSLLKDRKVVPDSDPPTTKDVDLLYEFFAKSTKLVALTGAGISTECGIPDYRSPNGAYSTGFKPITHQQFTRSSRARRRYWARSYAGWRKFNEAKPSPAHTALSSLEKANRITFMITQNVDRLHHRAGSSPLELHGTVYNVGCVDCGFL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_037603`
TK1151 ID	TkA04G328590
OH-1004 ID	LXL04_037603
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	89.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_037603

Location Chr09:15699706-15702870 (+)

Description Similar to SRT2: NAD-dependent protein deacylase SRT2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g09230`	NAD-dependent protein deacylase.	Arabidopsis putative deacetylase AtSRT2 regulates basal defense by suppressing PAD4, EDS5 and SID2 expression.2010 · DOI: 10.1093/pcp/pcq087 Histone Deacetylases SRT1 and SRT2 Interact with ENAP1 to Mediate Ethylene-Induced Transcriptional Repression.2018 · DOI: 10.1105/tpc.17.00671

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037603 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006541 glutamine metabolic process Biological Process

GO:0006974 DNA damage response Biological Process

GO:0007005 mitochondrion organization Biological Process

GO:0008340 determination of adult lifespan Biological Process

GO:0009267 cellular response to starvation Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0031348 negative regulation of defense response Biological Process

GO:0034983 peptidyl-lysine deacetylation Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0046322 negative regulation of fatty acid oxidation Biological Process

GO:0046889 positive regulation of lipid biosynthetic process Biological Process

GO:0071456 cellular response to hypoxia Biological Process

KEGG gene cross-reference

ath:AT5G09230

bta:519328

dme:Dmel_CG3187

hsa:23409

mmu:75387

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.556

Rank 1 · LXL04_037603 · OH-1004

Plastid0.457

Rank 2 · LXL04_037603 · OH-1004

Nucleus0.037

Rank 3 · LXL04_037603 · OH-1004

Cytoplasm0.037

Rank 4 · LXL04_037603 · OH-1004

Cell membrane0.010

Rank 5 · LXL04_037603 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02146.24SIR2150-364 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_037603	`PF02146.24`	SIR2	150	364	7.3e-43	147.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94AQ6`	Arabidopsis thaliana	NAD-dependent protein deacylase SRT2	73.235%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card